EMAIL THIS PAGE TO A FRIEND

GPX3

glutathione peroxidase 3 (plasma)

99 Gene Product Result for
Synonyms: GPx-P GSHPx-3 GSHPx-P
UniProtKB ID: P22352, O43787, Q86W78, Q9NZ74, Q9UEL1
Gene ID:
Human(2878) Summary: This gene product belongs to the glutathione peroxidase family, which functions in the detoxification of hydrogen peroxide. It contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Mouse(14778) glutathione peroxidase 3
Rat(64317) glutathione peroxidase 3
sheep(101104397) glutathione peroxidase 3 (plasma)
Domestic Rabbit(100343289) glutathione peroxidase 3 (plasma)
domestic guinea pig(100732539) glutathione peroxidase 3 (plasma)
naked mole-rat(101701549) glutathione peroxidase 3 (plasma)
Zebrafish(798788) glutathione peroxidase 3 (plasma)
Thale Cress(818936) glutathione peroxidase 3
cow(281210) glutathione peroxidase 3 (plasma)
Horse(100033835) glutathione peroxidase 3 (plasma)
domestic cat(101081442) glutathione peroxidase 3 (plasma)
dog(489179) glutathione peroxidase 3 (plasma)
chicken(427638) glutathione peroxidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G7297 Anti-GPX3 (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500485 Anti-GPX3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human, canine
ELISA, immunohistochemistry, western blot pricing
AV41491 Anti-GPX3 antibody produced in rabbit affinity isolated antibody bovine, canine, rat, mouse, human, pig, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002084 Rosetta Predictions human pricing
NM_022525 Rosetta Predictions rat pricing
NM_001083929 Rosetta Predictions mouse pricing
NM_008161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113187 predicted 931
2 SASI_Hs02_00333162 predicted 1077
3 SASI_Hs01_00113189 predicted 931
4 SASI_Hs01_00113193 predicted 552
5 SASI_Hs02_00333163 predicted 733
6 SASI_Hs02_00333164 predicted 885
7 SASI_Hs02_00333165 predicted 1033
8 SASI_Hs02_00333166 predicted 324
9 SASI_Hs02_00333167 predicted 706
10 SASI_Hs02_00333168 predicted 1085
11 SASI_Hs01_00113188 predicted 315
12 SASI_Hs01_00113190 predicted 651
13 SASI_Hs01_00113191 predicted 601
14 SASI_Hs01_00113192 predicted 605
15 SASI_Hs01_00113194 predicted 319
16 SASI_Hs01_00113195 predicted 642
17 SASI_Hs01_00113196 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086118 predicted 1110
2 SASI_Rn01_00086119 predicted 294
3 SASI_Rn01_00086121 predicted 1031
4 SASI_Rn02_00263274 predicted 249
5 SASI_Rn01_00086122 predicted 994
6 SASI_Rn01_00086123 predicted 825
7 SASI_Rn01_00086124 predicted 303
8 SASI_Rn01_00086125 predicted 230
9 SASI_Rn01_00086126 predicted 1134
10 SASI_Rn01_00086127 predicted 1047
11 SASI_Rn01_00086120 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300066 predicted 283
2 SASI_Mm02_00300067 predicted 374
3 SASI_Mm02_00300068 predicted 1128
4 SASI_Mm02_00300069 predicted 998
5 SASI_Mm02_00300070 predicted 1033
6 SASI_Mm02_00300071 predicted 392
7 SASI_Mm02_00300072 predicted 281
8 SASI_Mm02_00300073 predicted 346
9 SASI_Mm02_00300074 predicted 486
10 SASI_Mm02_00300075 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313267 predicted 208
2 SASI_Mm01_00171159 predicted 308
3 SASI_Mm01_00171161 predicted 1059
4 SASI_Mm02_00313268 predicted 930
5 SASI_Mm02_00313269 predicted 964
6 SASI_Mm02_00313270 predicted 319
7 SASI_Mm02_00313271 predicted 210
8 SASI_Mm02_00313272 predicted 275
9 SASI_Mm01_00171152 predicted 415
10 SASI_Mm01_00171153 predicted 437
11 SASI_Mm01_00171154 predicted 447
12 SASI_Mm01_00171155 predicted 408
13 SASI_Mm01_00171156 predicted 317
14 SASI_Mm01_00171157 predicted 1108
15 SASI_Mm01_00171158 predicted 242
16 SASI_Mm01_00171160 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002084
VALIDATED
GPX3 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 3 (plasma)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002084.2-1434s1c1
Sequence:CCGGGCCTCCAAATATTAGTAACTACTCGAGTAGTTACTAATATTTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002084.2-476s1c1
Sequence:CCGGGCTGGCAAATACGTCCTCTTTCTCGAGAAAGAGGACGTATTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002084.2-672s1c1
Sequence:CCGGGTGGAGGCTTTGTCCCTAATTCTCGAGAATTAGGGACAAAGCCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002084.2-399s1c1
Sequence:CCGGGTGGCATAAGTGGCACCATTTCTCGAGAAATGGTGCCACTTATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002084.2-733s1c1
Sequence:CCGGGCAGAAATTCTACACTTTCCTCTCGAGAGGAAAGTGTAGAATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-1352s21c1
Sequence:CCGGGCCTCCAAATATTAGTAACTACTCGAGTAGTTACTAATATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-344s21c1
Sequence:CCGGTACGGAGCCCTCACCATTGATCTCGAGATCAATGGTGAGGGCTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002084.3-652s21c1
Sequence:CCGGGCAGAAATTCTACACTTTCCTCTCGAGAGGAAAGTGTAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-486s21c1
Sequence:CCGGCACCATTCGGTCTGGTCATTCCTCGAGGAATGACCAGACCGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002084.3-591s21c1
Sequence:CCGGGTGGAGGCTTTGTCCCTAATTCTCGAGAATTAGGGACAAAGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002084
VALIDATED
GPX3 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 3 (plasma)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002084.2-1434s1c1
Sequence:CCGGGCCTCCAAATATTAGTAACTACTCGAGTAGTTACTAATATTTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002084.2-476s1c1
Sequence:CCGGGCTGGCAAATACGTCCTCTTTCTCGAGAAAGAGGACGTATTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002084.2-672s1c1
Sequence:CCGGGTGGAGGCTTTGTCCCTAATTCTCGAGAATTAGGGACAAAGCCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002084.2-399s1c1
Sequence:CCGGGTGGCATAAGTGGCACCATTTCTCGAGAAATGGTGCCACTTATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002084.2-733s1c1
Sequence:CCGGGCAGAAATTCTACACTTTCCTCTCGAGAGGAAAGTGTAGAATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-1352s21c1
Sequence:CCGGGCCTCCAAATATTAGTAACTACTCGAGTAGTTACTAATATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-344s21c1
Sequence:CCGGTACGGAGCCCTCACCATTGATCTCGAGATCAATGGTGAGGGCTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002084.3-652s21c1
Sequence:CCGGGCAGAAATTCTACACTTTCCTCTCGAGAGGAAAGTGTAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-486s21c1
Sequence:CCGGCACCATTCGGTCTGGTCATTCCTCGAGGAATGACCAGACCGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002084.3-591s21c1
Sequence:CCGGGTGGAGGCTTTGTCCCTAATTCTCGAGAATTAGGGACAAAGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002084
VALIDATED
GPX3 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 3 (plasma)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002084.2-1434s1c1
Sequence:CCGGGCCTCCAAATATTAGTAACTACTCGAGTAGTTACTAATATTTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002084.2-476s1c1
Sequence:CCGGGCTGGCAAATACGTCCTCTTTCTCGAGAAAGAGGACGTATTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002084.2-672s1c1
Sequence:CCGGGTGGAGGCTTTGTCCCTAATTCTCGAGAATTAGGGACAAAGCCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002084.2-399s1c1
Sequence:CCGGGTGGCATAAGTGGCACCATTTCTCGAGAAATGGTGCCACTTATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002084.2-733s1c1
Sequence:CCGGGCAGAAATTCTACACTTTCCTCTCGAGAGGAAAGTGTAGAATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-1352s21c1
Sequence:CCGGGCCTCCAAATATTAGTAACTACTCGAGTAGTTACTAATATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-344s21c1
Sequence:CCGGTACGGAGCCCTCACCATTGATCTCGAGATCAATGGTGAGGGCTCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002084.3-652s21c1
Sequence:CCGGGCAGAAATTCTACACTTTCCTCTCGAGAGGAAAGTGTAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002084.3-486s21c1
Sequence:CCGGCACCATTCGGTCTGGTCATTCCTCGAGGAATGACCAGACCGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002084.3-591s21c1
Sequence:CCGGGTGGAGGCTTTGTCCCTAATTCTCGAGAATTAGGGACAAAGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008161
GPX3 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 3 (plasma)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008161.1-796s1c1
Sequence:CCGGCCCAGATTCTCTTTCTTATTACTCGAGTAATAAGAAAGAGAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-314s1c1
Sequence:CCGGCCTTCCAACCAATTTGGCAAACTCGAGTTTGCCAAATTGGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-448s1c1
Sequence:CCGGAGAGCAGAAATTCTACACTTTCTCGAGAAAGTGTAGAATTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-194s1c1
Sequence:CCGGGCAGGCAAATATATCCTCTTTCTCGAGAAAGAGGATATATTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-260s1c1
Sequence:CCGGCTGAATGCACTACAAGAAGAACTCGAGTTCTTCTTGTAGTGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008161
GPX3 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 3 (plasma)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008161.1-796s1c1
Sequence:CCGGCCCAGATTCTCTTTCTTATTACTCGAGTAATAAGAAAGAGAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-314s1c1
Sequence:CCGGCCTTCCAACCAATTTGGCAAACTCGAGTTTGCCAAATTGGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-448s1c1
Sequence:CCGGAGAGCAGAAATTCTACACTTTCTCGAGAAAGTGTAGAATTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-194s1c1
Sequence:CCGGGCAGGCAAATATATCCTCTTTCTCGAGAAAGAGGATATATTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-260s1c1
Sequence:CCGGCTGAATGCACTACAAGAAGAACTCGAGTTCTTCTTGTAGTGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008161
GPX3 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 3 (plasma)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008161.1-796s1c1
Sequence:CCGGCCCAGATTCTCTTTCTTATTACTCGAGTAATAAGAAAGAGAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-314s1c1
Sequence:CCGGCCTTCCAACCAATTTGGCAAACTCGAGTTTGCCAAATTGGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-448s1c1
Sequence:CCGGAGAGCAGAAATTCTACACTTTCTCGAGAAAGTGTAGAATTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-194s1c1
Sequence:CCGGGCAGGCAAATATATCCTCTTTCTCGAGAAAGAGGATATATTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008161.1-260s1c1
Sequence:CCGGCTGAATGCACTACAAGAAGAACTCGAGTTCTTCTTGTAGTGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks