EMAIL THIS PAGE TO A FRIEND

GPX4

glutathione peroxidase 4

116 Gene Product Result for
Synonyms: GPx-4 GSHPx-4 MCSP PHGPx snGPx snPHGPx
UniProtKB ID: P36969, O43381, Q6PJ59, Q9UPK2
Gene ID:
Human(2879) Summary: Glutathione peroxidase catalyzes the reduction of hydrogen peroxide, organic hydroperoxide, and lipid peroxides by reduced glutathione and functions in the protection of cells against oxidative damage. Human plasma glutathione peroxidase has been shown to be a selenium-containing enzyme and the UGA codon is translated into a selenocysteine. Through alternative splicing and transcription initiation, rat produces proteins that localize to the nucleus, mitochondrion, and cytoplasm. In humans, experimental evidence for alternative splicing exists; alternative transcription initiation and the cleavage sites of the mitochondrial and nuclear transit peptides need to be experimentally verified. [provided by RefSeq, Jul 2008]
Mouse(625249) glutathione peroxidase 4
Rat(29328) glutathione peroxidase 4
Thale Cress(819427) glutathione peroxidase 4
domestic cat(101095956) glutathione peroxidase 4
chicken(374056) glutathione peroxidase 4
cow(286809) glutathione peroxidase 4
domestic guinea pig(100730119) glutathione peroxidase 4
naked mole-rat(101708875) glutathione peroxidase 4
Goat(100860867) glutathione peroxidase 4
sheep(101113149) glutathione peroxidase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_008162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119391 MISSION® esiRNA esiRNA human GPX4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039847 Rosetta Predictions human pricing
NM_001039848 Rosetta Predictions human pricing
NM_002085 Rosetta Predictions human pricing
NM_001039849 Rosetta Predictions rat pricing
NM_017165 Rosetta Predictions rat pricing
NM_001037741 Rosetta Predictions mouse pricing
NM_008162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308687 predicted 320
2 SASI_Hs01_00050315 predicted 256
3 SASI_Hs01_00050316 predicted 322
4 SASI_Hs01_00050317 predicted 217
5 SASI_Hs02_00308688 predicted 341
6 SASI_Hs01_00050319 predicted 372
7 SASI_Hs02_00308689 predicted 319
8 SASI_Hs02_00308690 predicted 364
9 SASI_Hs02_00308691 predicted 309
10 SASI_Hs02_00308692 predicted 318
11 SASI_Hs01_00050314 predicted 366
12 SASI_Hs01_00050318 predicted 255
13 SASI_Hs01_00050320 predicted 246
14 SASI_Hs01_00050321 predicted 358
15 SASI_Hs01_00050322 predicted 338
16 SASI_Hs01_00050323 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191236 predicted 521
2 SASI_Hs01_00191237 predicted 538
3 SASI_Hs01_00191238 predicted 525
4 SASI_Hs01_00191239 predicted 520
5 SASI_Hs01_00191240 predicted 629
6 SASI_Hs01_00191241 predicted 519
7 SASI_Hs01_00191242 predicted 490
8 SASI_Hs01_00191243 predicted 560
9 SASI_Hs01_00191244 predicted 689
10 SASI_Hs01_00191245 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085284 predicted 251
2 SASI_Hs01_00085287 predicted 366
3 SASI_Hs01_00085289 predicted 321
4 SASI_Hs02_00333169 predicted 214
5 SASI_Hs01_00085285 predicted 249
6 SASI_Hs01_00085290 predicted 377
7 SASI_Hs01_00085292 predicted 239
8 SASI_Hs02_00333170 predicted 359
9 SASI_Hs02_00333171 predicted 351
10 SASI_Hs02_00333172 predicted 325
11 SASI_Hs01_00085283 predicted 264
12 SASI_Hs01_00085286 predicted 216
13 SASI_Hs01_00085288 predicted 370
14 SASI_Hs01_00085291 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042429 predicted 536
2 SASI_Rn01_00042431 predicted 514
3 SASI_Rn01_00042432 predicted 491
4 SASI_Rn01_00042433 predicted 493
5 SASI_Rn01_00042434 predicted 604
6 SASI_Rn01_00042435 predicted 733
7 SASI_Rn01_00042436 predicted 518
8 SASI_Rn01_00042437 predicted 490
9 SASI_Rn01_00042438 predicted 639
10 SASI_Rn02_00204885 predicted 493
11 SASI_Rn01_00042430 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061966 predicted 440
2 SASI_Rn01_00061968 predicted 407
3 SASI_Rn01_00061969 predicted 389
4 SASI_Rn01_00061970 predicted 395
5 SASI_Rn01_00061971 predicted 493
6 SASI_Rn01_00061972 predicted 631
7 SASI_Rn01_00061973 predicted 416
8 SASI_Rn01_00061974 predicted 393
9 SASI_Rn01_00061975 predicted 544
10 SASI_Rn02_00261477 predicted 392
11 SASI_Rn01_00061967 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025232 predicted 527
2 SASI_Mm01_00025233 predicted 648
3 SASI_Mm01_00025234 predicted 603
4 SASI_Mm01_00025235 predicted 651
5 SASI_Mm02_00289389 predicted 502
6 SASI_Mm01_00025236 predicted 699
7 SASI_Mm01_00025237 predicted 706
8 SASI_Mm01_00025238 predicted 507
9 SASI_Mm01_00025239 predicted 563
10 SASI_Mm01_00025240 predicted 760
11 SASI_Mm01_00025241 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030963 predicted 467
2 SASI_Mm01_00030964 predicted 590
3 SASI_Mm01_00030965 predicted 539
4 SASI_Mm01_00030966 predicted 597
5 SASI_Mm02_00313273 predicted 445
6 SASI_Mm01_00030967 predicted 644
7 SASI_Mm01_00030968 predicted 649
8 SASI_Mm01_00030969 predicted 453
9 SASI_Mm01_00030970 predicted 499
10 SASI_Mm01_00030971 predicted 699
11 SASI_Mm01_00030972 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002085
VALIDATED
GPX4 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002085.3-764s21c1
Sequence:CCGGTCATGACGGCCTGCCTGCAAACTCGAGTTTGCAGGCAGGCCGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-323s21c1
Sequence:CCGGGTGAGGCAAGACCGAAGTAAACTCGAGTTTACTTCGGTCTTGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-260s21c1
Sequence:CCGGGCACATGGTTAACCTGGACAACTCGAGTTGTCCAGGTTAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-542s21c1
Sequence:CCGGGTGGATGAAGATCCAACCCAACTCGAGTTGGGTTGGATCTTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-473s21c1
Sequence:CCGGCTACAACGTCAAATTCGATATCTCGAGATATCGAATTTGACGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002085.1-746s1c1
Sequence:CCGGCCTGCCTGCAAACCTGCTGGTCTCGAGACCAGCAGGTTTGCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-515s1c1
Sequence:CCGGGTGGATGAAGATCCAACCCAACTCGAGTTGGGTTGGATCTTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-233s1c1
Sequence:CCGGGCACATGGTTAACCTGGACAACTCGAGTTGTCCAGGTTAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002085.1-455s1c1
Sequence:CCGGCAAATTCGATATGTTCAGCAACTCGAGTTGCTGAACATATCGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-296s1c1
Sequence:CCGGGTGAGGCAAGACCGAAGTAAACTCGAGTTTACTTCGGTCTTGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002085
VALIDATED
GPX4 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002085.3-764s21c1
Sequence:CCGGTCATGACGGCCTGCCTGCAAACTCGAGTTTGCAGGCAGGCCGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-323s21c1
Sequence:CCGGGTGAGGCAAGACCGAAGTAAACTCGAGTTTACTTCGGTCTTGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-260s21c1
Sequence:CCGGGCACATGGTTAACCTGGACAACTCGAGTTGTCCAGGTTAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-542s21c1
Sequence:CCGGGTGGATGAAGATCCAACCCAACTCGAGTTGGGTTGGATCTTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-473s21c1
Sequence:CCGGCTACAACGTCAAATTCGATATCTCGAGATATCGAATTTGACGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002085.1-746s1c1
Sequence:CCGGCCTGCCTGCAAACCTGCTGGTCTCGAGACCAGCAGGTTTGCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-515s1c1
Sequence:CCGGGTGGATGAAGATCCAACCCAACTCGAGTTGGGTTGGATCTTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-233s1c1
Sequence:CCGGGCACATGGTTAACCTGGACAACTCGAGTTGTCCAGGTTAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002085.1-455s1c1
Sequence:CCGGCAAATTCGATATGTTCAGCAACTCGAGTTGCTGAACATATCGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-296s1c1
Sequence:CCGGGTGAGGCAAGACCGAAGTAAACTCGAGTTTACTTCGGTCTTGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002085
VALIDATED
GPX4 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002085.3-764s21c1
Sequence:CCGGTCATGACGGCCTGCCTGCAAACTCGAGTTTGCAGGCAGGCCGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-323s21c1
Sequence:CCGGGTGAGGCAAGACCGAAGTAAACTCGAGTTTACTTCGGTCTTGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-260s21c1
Sequence:CCGGGCACATGGTTAACCTGGACAACTCGAGTTGTCCAGGTTAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-542s21c1
Sequence:CCGGGTGGATGAAGATCCAACCCAACTCGAGTTGGGTTGGATCTTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002085.3-473s21c1
Sequence:CCGGCTACAACGTCAAATTCGATATCTCGAGATATCGAATTTGACGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002085.1-746s1c1
Sequence:CCGGCCTGCCTGCAAACCTGCTGGTCTCGAGACCAGCAGGTTTGCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-515s1c1
Sequence:CCGGGTGGATGAAGATCCAACCCAACTCGAGTTGGGTTGGATCTTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-233s1c1
Sequence:CCGGGCACATGGTTAACCTGGACAACTCGAGTTGTCCAGGTTAACCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002085.1-455s1c1
Sequence:CCGGCAAATTCGATATGTTCAGCAACTCGAGTTGCTGAACATATCGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002085.1-296s1c1
Sequence:CCGGGTGAGGCAAGACCGAAGTAAACTCGAGTTTACTTCGGTCTTGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037741
GPX4 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-656s21c1
Sequence:CCGGATGCCATCAAATGGAACTTTACTCGAGTAAAGTTCCATTTGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-569s21c1
Sequence:CCGGACAGCAAGATCTGTGTAAATGCTCGAGCATTTACACAGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-542s21c1
Sequence:CCGGCCGGCTACAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-507s21c1
Sequence:CCGGGCCAGGAAGTAATCAAGAAATCTCGAGATTTCTTGATTACTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-430s21c1
Sequence:CCGGGTCGATCTGCATGCCCGATATCTCGAGATATCGGGCATGCAGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037741
GPX4 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-656s21c1
Sequence:CCGGATGCCATCAAATGGAACTTTACTCGAGTAAAGTTCCATTTGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-569s21c1
Sequence:CCGGACAGCAAGATCTGTGTAAATGCTCGAGCATTTACACAGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-542s21c1
Sequence:CCGGCCGGCTACAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-507s21c1
Sequence:CCGGGCCAGGAAGTAATCAAGAAATCTCGAGATTTCTTGATTACTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-430s21c1
Sequence:CCGGGTCGATCTGCATGCCCGATATCTCGAGATATCGGGCATGCAGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037741
GPX4 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-656s21c1
Sequence:CCGGATGCCATCAAATGGAACTTTACTCGAGTAAAGTTCCATTTGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-569s21c1
Sequence:CCGGACAGCAAGATCTGTGTAAATGCTCGAGCATTTACACAGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-542s21c1
Sequence:CCGGCCGGCTACAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-507s21c1
Sequence:CCGGGCCAGGAAGTAATCAAGAAATCTCGAGATTTCTTGATTACTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037741.2-430s21c1
Sequence:CCGGGTCGATCTGCATGCCCGATATCTCGAGATATCGGGCATGCAGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008162
GPX4 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008162.1-811s1c1
Sequence:CCGGCTCATGAAGGTCTGCCTGAAACTCGAGTTTCAGGCAGACCTTCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-627s1c1
Sequence:CCGGCAAATGGAACTTTACCAAGTTCTCGAGAACTTGGTAAAGTTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-471s1c1
Sequence:CCGGGCCAGGAAGTAATCAAGAAATCTCGAGATTTCTTGATTACTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-373s1c1
Sequence:CCGGGACGTAAACTACACTCAGCTACTCGAGTAGCTGAGTGTAGTTTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-567s1c1
Sequence:CCGGCCCACTGTGGAAATGGATGAACTCGAGTTCATCCATTTCCACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008162
GPX4 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008162.1-811s1c1
Sequence:CCGGCTCATGAAGGTCTGCCTGAAACTCGAGTTTCAGGCAGACCTTCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-627s1c1
Sequence:CCGGCAAATGGAACTTTACCAAGTTCTCGAGAACTTGGTAAAGTTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-471s1c1
Sequence:CCGGGCCAGGAAGTAATCAAGAAATCTCGAGATTTCTTGATTACTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-373s1c1
Sequence:CCGGGACGTAAACTACACTCAGCTACTCGAGTAGCTGAGTGTAGTTTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-567s1c1
Sequence:CCGGCCCACTGTGGAAATGGATGAACTCGAGTTCATCCATTTCCACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008162
GPX4 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008162.1-811s1c1
Sequence:CCGGCTCATGAAGGTCTGCCTGAAACTCGAGTTTCAGGCAGACCTTCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-627s1c1
Sequence:CCGGCAAATGGAACTTTACCAAGTTCTCGAGAACTTGGTAAAGTTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-471s1c1
Sequence:CCGGGCCAGGAAGTAATCAAGAAATCTCGAGATTTCTTGATTACTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-373s1c1
Sequence:CCGGGACGTAAACTACACTCAGCTACTCGAGTAGCTGAGTGTAGTTTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008162.1-567s1c1
Sequence:CCGGCCCACTGTGGAAATGGATGAACTCGAGTTCATCCATTTCCACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks