EMAIL THIS PAGE TO A FRIEND

GPX5

glutathione peroxidase 5 (epididymal androgen-related protein)

68 Gene Product Result for
UniProtKB ID: O75715, A1A4Y0
Gene ID:
Human(2880) Summary: This gene belongs to the glutathione peroxidase family. It is specifically expressed in the epididymis in the mammalian male reproductive tract, and is androgen-regulated. Unlike mRNAs for other characterized glutathione peroxidases, this mRNA does not contain a selenocysteine (UGA) codon. Thus, the encoded protein is selenium-independent, and has been proposed to play a role in protecting the membranes of spermatozoa from the damaging effects of lipid peroxidation and/or preventing premature acrosome reaction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2008]
Mouse(14780) glutathione peroxidase 5
Rat(113919) glutathione peroxidase 5
Thale Cress(825483) glutathione peroxidase 5
cow(525988) glutathione peroxidase 5 (epididymal androgen-related protein)
Horse(100034079) glutathione peroxidase 5 (epididymal androgen-related protein)
domestic cat(101087318) glutathione peroxidase 5 (epididymal androgen-related protein)
dog(403877) glutathione peroxidase 5 (epididymal androgen-related protein)
sheep(100913163) glutathione peroxidase 5 (epididymal androgen-related protein)
Domestic Rabbit(100346804) glutathione peroxidase 5 (epididymal androgen-related protein)
domestic guinea pig(100717332) glutathione peroxidase 5 (epididymal androgen-related protein)
naked mole-rat(101698603) glutathione peroxidase 5 (epididymal androgen-related protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230321 MISSION® esiRNA esiRNA targeting human GPX5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001509 Rosetta Predictions human pricing
NM_003996 Rosetta Predictions human pricing
NM_001105738 Rosetta Predictions rat pricing
NM_010343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070313 predicted 228
2 SASI_Hs01_00070315 predicted 271
3 SASI_Hs01_00070316 predicted 260
4 SASI_Hs01_00070317 predicted 261
5 SASI_Hs01_00070318 predicted 268
6 SASI_Hs01_00070320 predicted 209
7 SASI_Hs01_00070321 predicted 385
8 SASI_Hs01_00070322 predicted 276
9 SASI_Hs02_00332010 predicted 315
10 SASI_Hs02_00332011 predicted 264
11 SASI_Hs01_00070314 predicted 228
12 SASI_Hs01_00070319 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041421 predicted 223
2 SASI_Hs01_00041422 predicted 316
3 SASI_Hs01_00041423 predicted 315
4 SASI_Hs01_00041424 predicted 202
5 SASI_Hs01_00041425 predicted 260
6 SASI_Hs01_00041426 predicted 204
7 SASI_Hs02_00336715 predicted 257
8 SASI_Hs02_00336716 predicted 259
9 SASI_Hs02_00336717 predicted 258
10 SASI_Hs02_00336718 predicted 213
11 SASI_Hs01_00041417 predicted 330
12 SASI_Hs01_00041418 predicted 227
13 SASI_Hs01_00041419 predicted 221
14 SASI_Hs01_00041420 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212046 predicted 236
2 SASI_Rn02_00212047 predicted 320
3 SASI_Rn02_00212048 predicted 293
4 SASI_Rn02_00212049 predicted 295
5 SASI_Rn02_00212050 predicted 231
6 SASI_Rn02_00212051 predicted 460
7 SASI_Rn02_00212052 predicted 627
8 SASI_Rn02_00212053 predicted 527
9 SASI_Rn02_00212054 predicted 379
10 SASI_Rn02_00212055 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160199 predicted 507
2 SASI_Mm01_00160198 predicted 287
3 SASI_Mm01_00160200 predicted 296
4 SASI_Mm01_00160202 predicted 502
5 SASI_Mm02_00318356 predicted 524
6 SASI_Mm01_00160203 predicted 345
7 SASI_Mm01_00160205 predicted 622
8 SASI_Mm01_00160207 predicted 468
9 SASI_Mm02_00318357 predicted 662
10 SASI_Mm02_00318358 predicted 237
11 SASI_Mm01_00160201 predicted 328
12 SASI_Mm01_00160204 predicted 511
13 SASI_Mm01_00160206 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001509
GPX5 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 5 (epididymal androgen-related protein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-135s1c1
Sequence:CCGGGCCATCGCACTTAATAAGAATCTCGAGATTCTTATTAAGTGCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-327s1c1
Sequence:CCGGCCAGGAGATAACAAAGAGATTCTCGAGAATCTCTTTGTTATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-518s1c1
Sequence:CCGGCCCTGTAAAGGTCCATGACATCTCGAGATGTCATGGACCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-93s1c1
Sequence:CCGGGATTGCCACAAAGACGAGAAACTCGAGTTTCTCGTCTTTGTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-229s1c1
Sequence:CCGGCAGCGCAATATCCTGAACTAACTCGAGTTAGTTCAGGATATTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001509.2-1097s21c1
Sequence:CCGGAGGTTCCACTTCATAACATTTCTCGAGAAATGTTATGAAGTGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001509.2-791s21c1
Sequence:CCGGGAGTAAATCACCGCCACATACCTCGAGGTATGTGGCGGTGATTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001509.2-489s21c1
Sequence:CCGGTTGGGCACATTCAAATCTATACTCGAGTATAGATTTGAATGTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001509
GPX5 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 5 (epididymal androgen-related protein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-135s1c1
Sequence:CCGGGCCATCGCACTTAATAAGAATCTCGAGATTCTTATTAAGTGCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-327s1c1
Sequence:CCGGCCAGGAGATAACAAAGAGATTCTCGAGAATCTCTTTGTTATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-518s1c1
Sequence:CCGGCCCTGTAAAGGTCCATGACATCTCGAGATGTCATGGACCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-93s1c1
Sequence:CCGGGATTGCCACAAAGACGAGAAACTCGAGTTTCTCGTCTTTGTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-229s1c1
Sequence:CCGGCAGCGCAATATCCTGAACTAACTCGAGTTAGTTCAGGATATTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001509.2-1097s21c1
Sequence:CCGGAGGTTCCACTTCATAACATTTCTCGAGAAATGTTATGAAGTGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001509.2-791s21c1
Sequence:CCGGGAGTAAATCACCGCCACATACCTCGAGGTATGTGGCGGTGATTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001509.2-489s21c1
Sequence:CCGGTTGGGCACATTCAAATCTATACTCGAGTATAGATTTGAATGTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001509
GPX5 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 5 (epididymal androgen-related protein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-135s1c1
Sequence:CCGGGCCATCGCACTTAATAAGAATCTCGAGATTCTTATTAAGTGCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-327s1c1
Sequence:CCGGCCAGGAGATAACAAAGAGATTCTCGAGAATCTCTTTGTTATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-518s1c1
Sequence:CCGGCCCTGTAAAGGTCCATGACATCTCGAGATGTCATGGACCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-93s1c1
Sequence:CCGGGATTGCCACAAAGACGAGAAACTCGAGTTTCTCGTCTTTGTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001509.1-229s1c1
Sequence:CCGGCAGCGCAATATCCTGAACTAACTCGAGTTAGTTCAGGATATTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001509.2-1097s21c1
Sequence:CCGGAGGTTCCACTTCATAACATTTCTCGAGAAATGTTATGAAGTGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001509.2-791s21c1
Sequence:CCGGGAGTAAATCACCGCCACATACCTCGAGGTATGTGGCGGTGATTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001509.2-489s21c1
Sequence:CCGGTTGGGCACATTCAAATCTATACTCGAGTATAGATTTGAATGTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010343
GPX5 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 5 (epididymal androgen-related protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-117s1c1
Sequence:CCGGGACTGCTACAAAGACGTGAAACTCGAGTTTCACGTCTTTGTAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010343.1-1041s1c1
Sequence:CCGGGCCAGCCTAAGCTACAAGATACTCGAGTATCTTGTAGCTTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-60s1c1
Sequence:CCGGCCACTTCTTCTAGCCAGCTATCTCGAGATAGCTGGCTAGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-663s1c1
Sequence:CCGGGCGTACCTGAGCCATTTCAAACTCGAGTTTGAAATGGCTCAGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-351s1c1
Sequence:CCGGCCAGGAGACAATTTAGAGATTCTCGAGAATCTCTAAATTGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010343
GPX5 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 5 (epididymal androgen-related protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-117s1c1
Sequence:CCGGGACTGCTACAAAGACGTGAAACTCGAGTTTCACGTCTTTGTAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010343.1-1041s1c1
Sequence:CCGGGCCAGCCTAAGCTACAAGATACTCGAGTATCTTGTAGCTTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-60s1c1
Sequence:CCGGCCACTTCTTCTAGCCAGCTATCTCGAGATAGCTGGCTAGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-663s1c1
Sequence:CCGGGCGTACCTGAGCCATTTCAAACTCGAGTTTGAAATGGCTCAGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-351s1c1
Sequence:CCGGCCAGGAGACAATTTAGAGATTCTCGAGAATCTCTAAATTGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010343
GPX5 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 5 (epididymal androgen-related protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-117s1c1
Sequence:CCGGGACTGCTACAAAGACGTGAAACTCGAGTTTCACGTCTTTGTAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010343.1-1041s1c1
Sequence:CCGGGCCAGCCTAAGCTACAAGATACTCGAGTATCTTGTAGCTTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-60s1c1
Sequence:CCGGCCACTTCTTCTAGCCAGCTATCTCGAGATAGCTGGCTAGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-663s1c1
Sequence:CCGGGCGTACCTGAGCCATTTCAAACTCGAGTTTGAAATGGCTCAGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010343.1-351s1c1
Sequence:CCGGCCAGGAGACAATTTAGAGATTCTCGAGAATCTCTAAATTGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks