EMAIL THIS PAGE TO A FRIEND

GPX6

glutathione peroxidase 6 (olfactory)

70 Gene Product Result for
Synonyms: GPX5p GPXP3 GPx-6 GSHPx-6 dJ1186N24 dJ1186N24.1
UniProtKB ID: P59796, Q4PJ17
Gene ID:
Human(257202) Summary: This gene product belongs to the glutathione peroxidase family, which functions in the detoxification of hydrogen peroxide. It contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Expression of this gene is restricted to embryos and adult olfactory epithelium. [provided by RefSeq, Jul 2008]
Mouse(75512) glutathione peroxidase 6
Rat(259233) glutathione peroxidase 6
domestic guinea pig(100717614) glutathione peroxidase 6 (olfactory)
naked mole-rat(101698217) glutathione peroxidase 6 (olfactory)
sheep(101104098) glutathione peroxidase 6 (olfactory)
Domestic Rabbit(100341099) glutathione peroxidase 6 (olfactory)
Thale Cress(826765) glutathione peroxidase 6
dog(488328) glutathione peroxidase 6 (olfactory)
Horse(100061078) glutathione peroxidase 6 (olfactory)
cow(519280) glutathione peroxidase 6 (olfactory)
domestic cat(101087577) glutathione peroxidase 6 (olfactory)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182701 Rosetta Predictions human pricing
NM_147165 Rosetta Predictions rat pricing
NM_145451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201127 predicted 370
2 SASI_Hs01_00201128 predicted 374
3 SASI_Hs01_00201129 predicted 277
4 SASI_Hs01_00201130 predicted 1208
5 SASI_Hs01_00201131 predicted 324
6 SASI_Hs01_00201132 predicted 1200
7 SASI_Hs01_00201133 predicted 254
8 SASI_Hs01_00201134 predicted 264
9 SASI_Hs01_00201136 predicted 534
10 SASI_Hs01_00201135 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118967 predicted 379
2 SASI_Rn01_00118968 predicted 338
3 SASI_Rn02_00268860 predicted 380
4 SASI_Rn01_00118969 predicted 250
5 SASI_Rn01_00118970 predicted 517
6 SASI_Rn01_00118971 predicted 418
7 SASI_Rn01_00118972 predicted 310
8 SASI_Rn01_00118973 predicted 217
9 SASI_Rn02_00268861 predicted 340
10 SASI_Rn01_00118974 predicted 277
11 SASI_Rn01_00118966 predicted 216
12 SASI_Rn01_00118975 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147802 predicted 819
2 SASI_Mm01_00147803 predicted 807
3 SASI_Mm01_00147804 predicted 676
4 SASI_Mm01_00147805 predicted 821
5 SASI_Mm01_00147806 predicted 675
6 SASI_Mm01_00147808 predicted 707
7 SASI_Mm01_00147807 predicted 324
8 SASI_Mm01_00147809 predicted 799
9 SASI_Mm01_00147810 predicted 820
10 SASI_Mm02_00340838 predicted 1001
11 SASI_Mm01_00147811 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182701
GPX6 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 6 (olfactory)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182701.1-720s21c1
Sequence:CCGGGGGCTAGCGACTGACAGAAATCTCGAGATTTCTGTCAGTCGCTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182701.1-677s21c1
Sequence:CCGGAGACATCCTGGAGTACCTAAACTCGAGTTTAGGTACTCCAGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-200s1c1
Sequence:CCGGCGAGGAGTACATCCAATTCAACTCGAGTTGAATTGGATGTACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-228s1c1
Sequence:CCGGGCAGGCAAGCACGTCCTGTTTCTCGAGAAACAGGACGTGCTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-375s1c1
Sequence:CCGGCCAGGAACAAACTCAGAAATACTCGAGTATTTCTGAGTTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-279s1c1
Sequence:CCGGGCTCAGTATCCTGAACTGAATCTCGAGATTCAGTTCAGGATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-488s1c1
Sequence:CCGGGAAGGTCTTTACTTTCCTGAACTCGAGTTCAGGAAAGTAAAGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182701
GPX6 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 6 (olfactory)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182701.1-720s21c1
Sequence:CCGGGGGCTAGCGACTGACAGAAATCTCGAGATTTCTGTCAGTCGCTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182701.1-677s21c1
Sequence:CCGGAGACATCCTGGAGTACCTAAACTCGAGTTTAGGTACTCCAGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-200s1c1
Sequence:CCGGCGAGGAGTACATCCAATTCAACTCGAGTTGAATTGGATGTACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-228s1c1
Sequence:CCGGGCAGGCAAGCACGTCCTGTTTCTCGAGAAACAGGACGTGCTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-375s1c1
Sequence:CCGGCCAGGAACAAACTCAGAAATACTCGAGTATTTCTGAGTTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-279s1c1
Sequence:CCGGGCTCAGTATCCTGAACTGAATCTCGAGATTCAGTTCAGGATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-488s1c1
Sequence:CCGGGAAGGTCTTTACTTTCCTGAACTCGAGTTCAGGAAAGTAAAGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182701
GPX6 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 6 (olfactory)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182701.1-720s21c1
Sequence:CCGGGGGCTAGCGACTGACAGAAATCTCGAGATTTCTGTCAGTCGCTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182701.1-677s21c1
Sequence:CCGGAGACATCCTGGAGTACCTAAACTCGAGTTTAGGTACTCCAGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-200s1c1
Sequence:CCGGCGAGGAGTACATCCAATTCAACTCGAGTTGAATTGGATGTACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-228s1c1
Sequence:CCGGGCAGGCAAGCACGTCCTGTTTCTCGAGAAACAGGACGTGCTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-375s1c1
Sequence:CCGGCCAGGAACAAACTCAGAAATACTCGAGTATTTCTGAGTTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-279s1c1
Sequence:CCGGGCTCAGTATCCTGAACTGAATCTCGAGATTCAGTTCAGGATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182701.1-488s1c1
Sequence:CCGGGAAGGTCTTTACTTTCCTGAACTCGAGTTCAGGAAAGTAAAGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145451
GPX6 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 6 (olfactory)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145451.1-788s1c1
Sequence:CCGGGCATGTGCAATCTACAGAGATCTCGAGATCTCTGTAGATTGCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-546s1c1
Sequence:CCGGGATCCCATGAAGATTCATGATCTCGAGATCATGAATCTTCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-450s1c1
Sequence:CCGGGTGAACGGAGACAATGAACAACTCGAGTTGTTCATTGTCTCCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-629s1c1
Sequence:CCGGCCACCATACTCCTGTCAGAATCTCGAGATTCTGACAGGAGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-301s1c1
Sequence:CCGGAGCCATTCAACGTCACGGTTTCTCGAGAAACCGTGACGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145451
GPX6 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 6 (olfactory)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145451.1-788s1c1
Sequence:CCGGGCATGTGCAATCTACAGAGATCTCGAGATCTCTGTAGATTGCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-546s1c1
Sequence:CCGGGATCCCATGAAGATTCATGATCTCGAGATCATGAATCTTCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-450s1c1
Sequence:CCGGGTGAACGGAGACAATGAACAACTCGAGTTGTTCATTGTCTCCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-629s1c1
Sequence:CCGGCCACCATACTCCTGTCAGAATCTCGAGATTCTGACAGGAGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-301s1c1
Sequence:CCGGAGCCATTCAACGTCACGGTTTCTCGAGAAACCGTGACGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145451
GPX6 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 6 (olfactory)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145451.1-788s1c1
Sequence:CCGGGCATGTGCAATCTACAGAGATCTCGAGATCTCTGTAGATTGCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-546s1c1
Sequence:CCGGGATCCCATGAAGATTCATGATCTCGAGATCATGAATCTTCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-450s1c1
Sequence:CCGGGTGAACGGAGACAATGAACAACTCGAGTTGTTCATTGTCTCCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-629s1c1
Sequence:CCGGCCACCATACTCCTGTCAGAATCTCGAGATTCTGACAGGAGTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145451.1-301s1c1
Sequence:CCGGAGCCATTCAACGTCACGGTTTCTCGAGAAACCGTGACGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks