EMAIL THIS PAGE TO A FRIEND

GPX7

glutathione peroxidase 7

69 Gene Product Result for
Synonyms: CL683 GPX6 GPx-7 GSHPx-7 NPGPx
UniProtKB ID: Q96SL4, O95337, Q5T501
Gene ID:
Mouse(67305) glutathione peroxidase 7
Rat(298376) glutathione peroxidase 7
Zebrafish(552981) glutathione peroxidase 7
chicken(424643) glutathione peroxidase 7
cow(523311) glutathione peroxidase 7
domestic cat(101091642) glutathione peroxidase 7
dog(475348) glutathione peroxidase 7
Thale Cress(829316) glutathione peroxidase 7
Domestic Rabbit(100355382) glutathione peroxidase 7
domestic guinea pig(100724716) glutathione peroxidase 7
naked mole-rat(101709505) glutathione peroxidase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015696 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015696 Rosetta Predictions human pricing
NM_001106673 Rosetta Predictions rat pricing
NM_024198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215278 predicted 322
2 SASI_Hs02_00348359 predicted 518
3 SASI_Hs01_00215279 predicted 563
4 SASI_Hs01_00215280 predicted 456
5 SASI_Hs01_00215281 predicted 395
6 SASI_Hs01_00215282 predicted 341
7 SASI_Hs02_00348360 predicted 311
8 SASI_Hs01_00215283 predicted 320
9 SASI_Hs01_00215284 predicted 585
10 SASI_Hs01_00215285 predicted 346
11 SASI_Hs01_00215277 predicted 656
12 SASI_Hs01_00215286 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221258 predicted 710
2 SASI_Rn02_00221259 predicted 462
3 SASI_Rn02_00221260 predicted 475
4 SASI_Rn02_00221261 predicted 582
5 SASI_Rn02_00221262 predicted 765
6 SASI_Rn02_00221263 predicted 309
7 SASI_Rn02_00221264 predicted 559
8 SASI_Rn02_00221265 predicted 204
9 SASI_Rn02_00221266 predicted 591
10 SASI_Rn02_00221267 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327535 predicted 858
2 SASI_Mm02_00327536 predicted 900
3 SASI_Mm02_00327537 predicted 794
4 SASI_Mm01_00169560 predicted 695
5 SASI_Mm02_00327538 predicted 976
6 SASI_Mm01_00169561 predicted 752
7 SASI_Mm02_00327539 predicted 963
8 SASI_Mm01_00169563 predicted 684
9 SASI_Mm02_00327540 predicted 886
10 SASI_Mm02_00327541 predicted 849
11 SASI_Mm01_00169562 predicted 415
12 SASI_Mm01_00169564 predicted 481
13 SASI_Mm01_00169565 predicted 642
14 SASI_Mm01_00169566 predicted 542
15 SASI_Mm01_00169567 predicted 271
16 SASI_Mm01_00169568 predicted 285
17 SASI_Mm01_00169569 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015696
GPX7 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-319s1c1
Sequence:CCGGCCTGACAGCAACAAGGAGATTCTCGAGAATCTCCTTGTTGCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-354s1c1
Sequence:CCGGCCGCACCTACAGTGTCTCATTCTCGAGAATGAGACACTGTAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-463s1c1
Sequence:CCGGTGGAACTTCTGGAAGTACCTACTCGAGTAGGTACTTCCAGAAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-579s1c1
Sequence:CCGGCCTACTGAAGCGAGAAGACTTCTCGAGAAGTCTTCTCGCTTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-105s1c1
Sequence:CCGGGCAGGACTTCTACGACTTCAACTCGAGTTGAAGTCGTAGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015696.4-915s21c1
Sequence:CCGGGTAAACTGGGACCAATGATTACTCGAGTAATCATTGGTCCCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015696.4-389s21c1
Sequence:CCGGAGATTGCAGTCACCGGTACTGCTCGAGCAGTACCGGTGACTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015696.4-772s21c1
Sequence:CCGGTTGAATCTTACAGCAACAAATCTCGAGATTTGTTGCTGTAAGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015696
GPX7 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-319s1c1
Sequence:CCGGCCTGACAGCAACAAGGAGATTCTCGAGAATCTCCTTGTTGCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-354s1c1
Sequence:CCGGCCGCACCTACAGTGTCTCATTCTCGAGAATGAGACACTGTAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-463s1c1
Sequence:CCGGTGGAACTTCTGGAAGTACCTACTCGAGTAGGTACTTCCAGAAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-579s1c1
Sequence:CCGGCCTACTGAAGCGAGAAGACTTCTCGAGAAGTCTTCTCGCTTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-105s1c1
Sequence:CCGGGCAGGACTTCTACGACTTCAACTCGAGTTGAAGTCGTAGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015696.4-915s21c1
Sequence:CCGGGTAAACTGGGACCAATGATTACTCGAGTAATCATTGGTCCCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015696.4-389s21c1
Sequence:CCGGAGATTGCAGTCACCGGTACTGCTCGAGCAGTACCGGTGACTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015696.4-772s21c1
Sequence:CCGGTTGAATCTTACAGCAACAAATCTCGAGATTTGTTGCTGTAAGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015696
GPX7 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-319s1c1
Sequence:CCGGCCTGACAGCAACAAGGAGATTCTCGAGAATCTCCTTGTTGCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-354s1c1
Sequence:CCGGCCGCACCTACAGTGTCTCATTCTCGAGAATGAGACACTGTAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-463s1c1
Sequence:CCGGTGGAACTTCTGGAAGTACCTACTCGAGTAGGTACTTCCAGAAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-579s1c1
Sequence:CCGGCCTACTGAAGCGAGAAGACTTCTCGAGAAGTCTTCTCGCTTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015696.2-105s1c1
Sequence:CCGGGCAGGACTTCTACGACTTCAACTCGAGTTGAAGTCGTAGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015696.4-915s21c1
Sequence:CCGGGTAAACTGGGACCAATGATTACTCGAGTAATCATTGGTCCCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015696.4-389s21c1
Sequence:CCGGAGATTGCAGTCACCGGTACTGCTCGAGCAGTACCGGTGACTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015696.4-772s21c1
Sequence:CCGGTTGAATCTTACAGCAACAAATCTCGAGATTTGTTGCTGTAAGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024198
GPX7 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024198.1-756s1c1
Sequence:CCGGTGAGAGTTCTTAACAGCACATCTCGAGATGTGCTGTTAAGAACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-553s1c1
Sequence:CCGGAGAGCAGGTGATGAAACTCATCTCGAGATGAGTTTCATCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-557s1c1
Sequence:CCGGCAGGTGATGAAACTCATCCTTCTCGAGAAGGATGAGTTTCATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-349s1c1
Sequence:CCGGCCGCACCTACAGTGTCTCTTTCTCGAGAAAGAGACACTGTAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-574s1c1
Sequence:CCGGCCTTCGGAAACGAGAAGACTTCTCGAGAAGTCTTCTCGTTTCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024198
GPX7 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024198.1-756s1c1
Sequence:CCGGTGAGAGTTCTTAACAGCACATCTCGAGATGTGCTGTTAAGAACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-553s1c1
Sequence:CCGGAGAGCAGGTGATGAAACTCATCTCGAGATGAGTTTCATCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-557s1c1
Sequence:CCGGCAGGTGATGAAACTCATCCTTCTCGAGAAGGATGAGTTTCATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-349s1c1
Sequence:CCGGCCGCACCTACAGTGTCTCTTTCTCGAGAAAGAGACACTGTAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-574s1c1
Sequence:CCGGCCTTCGGAAACGAGAAGACTTCTCGAGAAGTCTTCTCGTTTCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024198
GPX7 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024198.1-756s1c1
Sequence:CCGGTGAGAGTTCTTAACAGCACATCTCGAGATGTGCTGTTAAGAACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-553s1c1
Sequence:CCGGAGAGCAGGTGATGAAACTCATCTCGAGATGAGTTTCATCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-557s1c1
Sequence:CCGGCAGGTGATGAAACTCATCCTTCTCGAGAAGGATGAGTTTCATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-349s1c1
Sequence:CCGGCCGCACCTACAGTGTCTCTTTCTCGAGAAAGAGACACTGTAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024198.1-574s1c1
Sequence:CCGGCCTTCGGAAACGAGAAGACTTCTCGAGAAGTCTTCTCGTTTCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks