EMAIL THIS PAGE TO A FRIEND

GPX8

glutathione peroxidase 8 (putative)

113 Gene Product Result for
Synonyms: EPLA847 GPx-8 GSHPx-8 UNQ847
UniProtKB ID: Q8TED1
Gene ID:
Mouse(69590) glutathione peroxidase 8 (putative)
Rat(294744) glutathione peroxidase 8
domestic guinea pig(100714207) glutathione peroxidase 8 (putative)
naked mole-rat(101726259) glutathione peroxidase 8 (putative)
sheep(101116602) glutathione peroxidase 8 (putative)
Zebrafish(393191) glutathione peroxidase 8 (putative)
cow(511575) glutathione peroxidase 8 (putative)
domestic cat(101087197) glutathione peroxidase 8 (putative)
dog(478059) glutathione peroxidase 8 (putative)
chicken(426170) glutathione peroxidase 8 (putative)
Thale Cress(842652) glutathione peroxidase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008397 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016961 MISSION® esiRNA esiRNA targeting mouse 2310016C16Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008397 Rosetta Predictions human pricing
NM_001106411 Rosetta Predictions rat pricing
NM_027127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171719 predicted 267
2 SASI_Hs01_00171720 predicted 382
3 SASI_Hs01_00171721 predicted 448
4 SASI_Hs01_00171722 predicted 467
5 SASI_Hs01_00171724 predicted 261
6 SASI_Hs01_00171725 predicted 430
7 SASI_Hs01_00171727 predicted 310
8 SASI_Hs01_00171728 predicted 326
9 SASI_Hs02_00305436 predicted 475
10 SASI_Hs02_00305437 predicted 288
11 SASI_Hs01_00171723 predicted 256
12 SASI_Hs01_00171726 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218698 predicted 595
2 SASI_Rn02_00218699 predicted 735
3 SASI_Rn02_00218700 predicted 309
4 SASI_Rn02_00218701 predicted 609
5 SASI_Rn02_00218702 predicted 229
6 SASI_Rn02_00218703 predicted 474
7 SASI_Rn02_00218704 predicted 271
8 SASI_Rn02_00218705 predicted 836
9 SASI_Rn02_00218706 predicted 475
10 SASI_Rn02_00218707 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110518 predicted 573
2 SASI_Mm01_00110519 predicted 292
3 SASI_Mm01_00110520 predicted 454
4 SASI_Mm01_00110521 predicted 655
5 SASI_Mm02_00331599 predicted 250
6 SASI_Mm01_00110522 predicted 362
7 SASI_Mm01_00110523 predicted 289
8 SASI_Mm01_00110524 predicted 208
9 SASI_Mm01_00110525 predicted 234
10 SASI_Mm01_00110526 predicted 576
11 SASI_Mm01_00110527 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027127
VALIDATED
GPX8 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 8 (putative)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027127.2-332s21c1
Sequence:CCGGCCGTGCAATCAGTTTGGAGAACTCGAGTTCTCCAAACTGATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-458s21c1
Sequence:CCGGCCTGCGTTTAGATTTATTGTTCTCGAGAACAATAAATCTAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-806s21c1
Sequence:CCGGCCAACCCATGATGAAGTATATCTCGAGATATACTTCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-587s21c1
Sequence:CCGGCCTCATGTATCACAAATGATTCTCGAGAATCATTTGTGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027127.1-807s1c1
Sequence:CCGGCCAACCCATGATGAAGTATATCTCGAGATATACTTCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027127.1-459s1c1
Sequence:CCGGCCTGCGTTTAGATTTATTGTTCTCGAGAACAATAAATCTAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027127.1-333s1c1
Sequence:CCGGCCGTGCAATCAGTTTGGAGAACTCGAGTTCTCCAAACTGATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027127.1-588s1c1
Sequence:CCGGCCTCATGTATCACAAATGATTCTCGAGAATCATTTGTGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027127.1-161s1c1
Sequence:CCGGCTTTGAAGTAAAGGATGCCAACTCGAGTTGGCATCCTTTACTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027127
VALIDATED
GPX8 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 8 (putative)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027127.2-332s21c1
Sequence:CCGGCCGTGCAATCAGTTTGGAGAACTCGAGTTCTCCAAACTGATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-458s21c1
Sequence:CCGGCCTGCGTTTAGATTTATTGTTCTCGAGAACAATAAATCTAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-806s21c1
Sequence:CCGGCCAACCCATGATGAAGTATATCTCGAGATATACTTCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-587s21c1
Sequence:CCGGCCTCATGTATCACAAATGATTCTCGAGAATCATTTGTGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027127.1-807s1c1
Sequence:CCGGCCAACCCATGATGAAGTATATCTCGAGATATACTTCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027127.1-459s1c1
Sequence:CCGGCCTGCGTTTAGATTTATTGTTCTCGAGAACAATAAATCTAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027127.1-333s1c1
Sequence:CCGGCCGTGCAATCAGTTTGGAGAACTCGAGTTCTCCAAACTGATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027127.1-588s1c1
Sequence:CCGGCCTCATGTATCACAAATGATTCTCGAGAATCATTTGTGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027127.1-161s1c1
Sequence:CCGGCTTTGAAGTAAAGGATGCCAACTCGAGTTGGCATCCTTTACTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027127
VALIDATED
GPX8 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 8 (putative)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027127.2-332s21c1
Sequence:CCGGCCGTGCAATCAGTTTGGAGAACTCGAGTTCTCCAAACTGATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-458s21c1
Sequence:CCGGCCTGCGTTTAGATTTATTGTTCTCGAGAACAATAAATCTAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-806s21c1
Sequence:CCGGCCAACCCATGATGAAGTATATCTCGAGATATACTTCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027127.2-587s21c1
Sequence:CCGGCCTCATGTATCACAAATGATTCTCGAGAATCATTTGTGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027127.1-807s1c1
Sequence:CCGGCCAACCCATGATGAAGTATATCTCGAGATATACTTCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027127.1-459s1c1
Sequence:CCGGCCTGCGTTTAGATTTATTGTTCTCGAGAACAATAAATCTAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027127.1-333s1c1
Sequence:CCGGCCGTGCAATCAGTTTGGAGAACTCGAGTTCTCCAAACTGATTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027127.1-588s1c1
Sequence:CCGGCCTCATGTATCACAAATGATTCTCGAGAATCATTTGTGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027127.1-161s1c1
Sequence:CCGGCTTTGAAGTAAAGGATGCCAACTCGAGTTGGCATCCTTTACTTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008397
VALIDATED
GPX8 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 8 (putative)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-1098s1c1
Sequence:CCGGGCACTGTGTATGACTGAAATTCTCGAGAATTTCAGTCATACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-623s1c1
Sequence:CCGGCTGGTTAGACAAGTGATCATACTCGAGTATGATCACTTGTCTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-387s1c1
Sequence:CCGGCAAGCAAGGAAGTAGAATCTTCTCGAGAAGATTCTACTTCCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-283s1c1
Sequence:CCGGCAGAAATTACTTAGGGCTGAACTCGAGTTCAGCCCTAAGTAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-78s1c1
Sequence:CCGGGAGCAAAGGTATTTGCAGTTTCTCGAGAAACTGCAAATACCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-669s1c1
Sequence:CCGGGCCATTGCGTTTCTAATAGAACTCGAGTTCTATTAGAAACGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008397.1-204s1c1
Sequence:CCGGGAAGAACTGTTTCTCTGGAAACTCGAGTTTCCAGAGAAACAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-181s1c1
Sequence:CCGGCTTTGAAGTGAAGGATGCAAACTCGAGTTTGCATCCTTCACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-468s1c1
Sequence:CCGGCTGAAGGAGAACCTGCATTTACTCGAGTAAATGCAGGTTCTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008397.1-596s1c1
Sequence:CCGGGAAGTCATCAGGCCTGACATACTCGAGTATGTCAGGCCTGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-74s1c1
Sequence:CCGGCCCAGAGCAAAGGTATTTGCACTCGAGTGCAAATACCTTTGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-609s1c1
Sequence:CCGGCTGACATAGCAGCTCTGGTTACTCGAGTAACCAGAGCTGCTATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-703s1c1
Sequence:CCGGCCATGAGGGTTTGGTCTCATTCTCGAGAATGAGACCAAACCCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008397
VALIDATED
GPX8 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 8 (putative)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-1098s1c1
Sequence:CCGGGCACTGTGTATGACTGAAATTCTCGAGAATTTCAGTCATACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-623s1c1
Sequence:CCGGCTGGTTAGACAAGTGATCATACTCGAGTATGATCACTTGTCTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-387s1c1
Sequence:CCGGCAAGCAAGGAAGTAGAATCTTCTCGAGAAGATTCTACTTCCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-283s1c1
Sequence:CCGGCAGAAATTACTTAGGGCTGAACTCGAGTTCAGCCCTAAGTAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-78s1c1
Sequence:CCGGGAGCAAAGGTATTTGCAGTTTCTCGAGAAACTGCAAATACCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-669s1c1
Sequence:CCGGGCCATTGCGTTTCTAATAGAACTCGAGTTCTATTAGAAACGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008397.1-204s1c1
Sequence:CCGGGAAGAACTGTTTCTCTGGAAACTCGAGTTTCCAGAGAAACAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-181s1c1
Sequence:CCGGCTTTGAAGTGAAGGATGCAAACTCGAGTTTGCATCCTTCACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-468s1c1
Sequence:CCGGCTGAAGGAGAACCTGCATTTACTCGAGTAAATGCAGGTTCTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008397.1-596s1c1
Sequence:CCGGGAAGTCATCAGGCCTGACATACTCGAGTATGTCAGGCCTGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-74s1c1
Sequence:CCGGCCCAGAGCAAAGGTATTTGCACTCGAGTGCAAATACCTTTGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-609s1c1
Sequence:CCGGCTGACATAGCAGCTCTGGTTACTCGAGTAACCAGAGCTGCTATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-703s1c1
Sequence:CCGGCCATGAGGGTTTGGTCTCATTCTCGAGAATGAGACCAAACCCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008397
VALIDATED
GPX8 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 8 (putative)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-1098s1c1
Sequence:CCGGGCACTGTGTATGACTGAAATTCTCGAGAATTTCAGTCATACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-623s1c1
Sequence:CCGGCTGGTTAGACAAGTGATCATACTCGAGTATGATCACTTGTCTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-387s1c1
Sequence:CCGGCAAGCAAGGAAGTAGAATCTTCTCGAGAAGATTCTACTTCCTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-283s1c1
Sequence:CCGGCAGAAATTACTTAGGGCTGAACTCGAGTTCAGCCCTAAGTAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-78s1c1
Sequence:CCGGGAGCAAAGGTATTTGCAGTTTCTCGAGAAACTGCAAATACCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-669s1c1
Sequence:CCGGGCCATTGCGTTTCTAATAGAACTCGAGTTCTATTAGAAACGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008397.1-204s1c1
Sequence:CCGGGAAGAACTGTTTCTCTGGAAACTCGAGTTTCCAGAGAAACAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-181s1c1
Sequence:CCGGCTTTGAAGTGAAGGATGCAAACTCGAGTTTGCATCCTTCACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-468s1c1
Sequence:CCGGCTGAAGGAGAACCTGCATTTACTCGAGTAAATGCAGGTTCTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008397.1-596s1c1
Sequence:CCGGGAAGTCATCAGGCCTGACATACTCGAGTATGTCAGGCCTGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-74s1c1
Sequence:CCGGCCCAGAGCAAAGGTATTTGCACTCGAGTGCAAATACCTTTGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008397.1-609s1c1
Sequence:CCGGCTGACATAGCAGCTCTGGTTACTCGAGTAACCAGAGCTGCTATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001008397.1-703s1c1
Sequence:CCGGCCATGAGGGTTTGGTCTCATTCTCGAGAATGAGACCAAACCCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks