EMAIL THIS PAGE TO A FRIEND

GRAMD1A

GRAM domain containing 1A

100 Gene Product Result for
Synonyms: KIAA1533
UniProtKB ID: Q96CP6, A6NKY7, Q8NC77, Q9P1Z5
Gene ID:
Mouse(52857) GRAM domain containing 1A
Rat(361550) GRAM domain containing 1A
Zebrafish(555994) GRAM domain containing 1A
dog(484585) GRAM domain containing 1A
domestic cat(101080344) GRAM domain containing 1A
cow(507027) GRAM domain containing 1A
Horse(100058841) GRAM domain containing 1A
sheep(101122883) GRAM domain containing 1A
domestic guinea pig(100718475) GRAM domain containing 1A
naked mole-rat(101709918) GRAM domain containing 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132991 MISSION® esiRNA esiRNA human GRAMD1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020895 Rosetta Predictions human pricing
NM_001014160 Rosetta Predictions rat pricing
NM_027898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236816 predicted 404
2 SASI_Hs01_00236818 predicted 411
3 SASI_Hs01_00236819 predicted 508
4 SASI_Hs01_00236820 predicted 364
5 SASI_Hs01_00236821 predicted 1292
6 SASI_Hs01_00236822 predicted 396
7 SASI_Hs02_00354214 predicted 1729
8 SASI_Hs02_00354215 predicted 406
9 SASI_Hs02_00354216 predicted 1622
10 SASI_Hs02_00354217 predicted 397
11 SASI_Hs01_00236817 predicted 592
12 SASI_Hs01_00236823 predicted 1746
13 SASI_Hs01_00236824 predicted 1161
14 SASI_Hs01_00236825 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072618 predicted 240
2 SASI_Rn01_00072619 predicted 406
3 SASI_Rn02_00201647 predicted 1609
4 SASI_Rn01_00072621 predicted 220
5 SASI_Rn01_00072622 predicted 1129
6 SASI_Rn01_00072623 predicted 2175
7 SASI_Rn01_00072624 predicted 1459
8 SASI_Rn01_00072625 predicted 478
9 SASI_Rn01_00072626 predicted 999
10 SASI_Rn01_00072627 predicted 1397
11 SASI_Rn01_00072620 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048663 predicted 2234
2 SASI_Mm01_00048664 predicted 591
3 SASI_Mm01_00048665 predicted 532
4 SASI_Mm01_00048666 predicted 2341
5 SASI_Mm01_00048667 predicted 577
6 SASI_Mm01_00048668 predicted 649
7 SASI_Mm01_00048669 predicted 1983
8 SASI_Mm02_00332869 predicted 348
9 SASI_Mm02_00332870 predicted 390
10 SASI_Mm01_00048670 predicted 612
11 SASI_Mm01_00048671 predicted 1394
12 SASI_Mm01_00048672 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020895
VALIDATED
GRAMD1A MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 1A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020895.2-1673s1c1
Sequence:CCGGCGCTCATTGAGAAGAACTCGTCTCGAGACGAGTTCTTCTCAATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-397s1c1
Sequence:CCGGCCCACTTATAAGCAGCGTAATCTCGAGATTACGCTGCTTATAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-1178s1c1
Sequence:CCGGCAGACACAAGTAACTCCTCTTCTCGAGAAGAGGAGTTACTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-598s1c1
Sequence:CCGGGTGACATGTCTGAAGAAGGAACTCGAGTTCCTTCTTCAGACATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-1668s1c1
Sequence:CCGGGAAGTCGCTCATTGAGAAGAACTCGAGTTCTTCTCAATGAGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-665s1c1
Sequence:CCGGGCGAGAAGCATTTCTTCACTTCTCGAGAAGTGAAGAAATGCTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020895.2-540s1c1
Sequence:CCGGCTGCTTCTACAGCAACATCTTCTCGAGAAGATGTTGCTGTAGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-360s21c1
Sequence:CCGGATGCAGAGCTGGTACAGTATGCTCGAGCATACTGTACCAGCTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-1686s21c1
Sequence:CCGGAGCGGCATTGAAGACTATTTCCTCGAGGAAATAGTCTTCAATGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-1977s21c1
Sequence:CCGGGTGATCTGTGTGAGCCTTATCCTCGAGGATAAGGCTCACACAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020895.3-2458s21c1
Sequence:CCGGACGGAACCGAGATGCACTTTACTCGAGTAAAGTGCATCTCGGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-439s21c1
Sequence:CCGGCCGAAGCAGAACGCCTCATTGCTCGAGCAATGAGGCGTTCTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020895
VALIDATED
GRAMD1A MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 1A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020895.2-1673s1c1
Sequence:CCGGCGCTCATTGAGAAGAACTCGTCTCGAGACGAGTTCTTCTCAATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-397s1c1
Sequence:CCGGCCCACTTATAAGCAGCGTAATCTCGAGATTACGCTGCTTATAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-1178s1c1
Sequence:CCGGCAGACACAAGTAACTCCTCTTCTCGAGAAGAGGAGTTACTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-598s1c1
Sequence:CCGGGTGACATGTCTGAAGAAGGAACTCGAGTTCCTTCTTCAGACATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-1668s1c1
Sequence:CCGGGAAGTCGCTCATTGAGAAGAACTCGAGTTCTTCTCAATGAGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-665s1c1
Sequence:CCGGGCGAGAAGCATTTCTTCACTTCTCGAGAAGTGAAGAAATGCTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020895.2-540s1c1
Sequence:CCGGCTGCTTCTACAGCAACATCTTCTCGAGAAGATGTTGCTGTAGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-360s21c1
Sequence:CCGGATGCAGAGCTGGTACAGTATGCTCGAGCATACTGTACCAGCTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-1686s21c1
Sequence:CCGGAGCGGCATTGAAGACTATTTCCTCGAGGAAATAGTCTTCAATGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-1977s21c1
Sequence:CCGGGTGATCTGTGTGAGCCTTATCCTCGAGGATAAGGCTCACACAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020895.3-2458s21c1
Sequence:CCGGACGGAACCGAGATGCACTTTACTCGAGTAAAGTGCATCTCGGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-439s21c1
Sequence:CCGGCCGAAGCAGAACGCCTCATTGCTCGAGCAATGAGGCGTTCTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020895
VALIDATED
GRAMD1A MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 1A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020895.2-1673s1c1
Sequence:CCGGCGCTCATTGAGAAGAACTCGTCTCGAGACGAGTTCTTCTCAATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-397s1c1
Sequence:CCGGCCCACTTATAAGCAGCGTAATCTCGAGATTACGCTGCTTATAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-1178s1c1
Sequence:CCGGCAGACACAAGTAACTCCTCTTCTCGAGAAGAGGAGTTACTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-598s1c1
Sequence:CCGGGTGACATGTCTGAAGAAGGAACTCGAGTTCCTTCTTCAGACATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-1668s1c1
Sequence:CCGGGAAGTCGCTCATTGAGAAGAACTCGAGTTCTTCTCAATGAGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020895.2-665s1c1
Sequence:CCGGGCGAGAAGCATTTCTTCACTTCTCGAGAAGTGAAGAAATGCTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020895.2-540s1c1
Sequence:CCGGCTGCTTCTACAGCAACATCTTCTCGAGAAGATGTTGCTGTAGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-360s21c1
Sequence:CCGGATGCAGAGCTGGTACAGTATGCTCGAGCATACTGTACCAGCTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-1686s21c1
Sequence:CCGGAGCGGCATTGAAGACTATTTCCTCGAGGAAATAGTCTTCAATGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-1977s21c1
Sequence:CCGGGTGATCTGTGTGAGCCTTATCCTCGAGGATAAGGCTCACACAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020895.3-2458s21c1
Sequence:CCGGACGGAACCGAGATGCACTTTACTCGAGTAAAGTGCATCTCGGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020895.3-439s21c1
Sequence:CCGGCCGAAGCAGAACGCCTCATTGCTCGAGCAATGAGGCGTTCTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027898
VALIDATED
GRAMD1A MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 1A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-923s1c1
Sequence:CCGGGCTGTCTAGAGAGGAACTATTCTCGAGAATAGTTCCTCTCTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-335s1c1
Sequence:CCGGGACCACAATTTCCATCCAGTTCTCGAGAACTGGATGGAAATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027898.2-1472s1c1
Sequence:CCGGCGAAGATTATTTCCACCACCTCTCGAGAGGTGGTGGAAATAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027898.2-2227s1c1
Sequence:CCGGCATAGAACCAAGATGCACTTTCTCGAGAAAGTGCATCTTGGTTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-1385s1c1
Sequence:CCGGGCTTCGTGTATCCTCAGAGATCTCGAGATCTCTGAGGATACACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-192s1c1
Sequence:CCGGCGGAAACTGTTCAGCAAACTTCTCGAGAAGTTTGCTGAACAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027898.3-2241s21c1
Sequence:CCGGGAAGCTACATCAAGGAATTACCTCGAGGTAATTCCTTGATGTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-462s21c1
Sequence:CCGGAGAGCGCCTCATCGTGGATTACTCGAGTAATCCACGATGAGGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027898.3-2465s21c1
Sequence:CCGGCATAGAACCAAGATGCACTTTCTCGAGAAAGTGCATCTTGGTTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-565s21c1
Sequence:CCGGTTCCGCTGGGAGACCACAATTCTCGAGAATTGTGGTCTCCCAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-1177s21c1
Sequence:CCGGCTATTGACAGACACGAGTAACCTCGAGGTTACTCGTGTCTGTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027898
VALIDATED
GRAMD1A MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 1A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-923s1c1
Sequence:CCGGGCTGTCTAGAGAGGAACTATTCTCGAGAATAGTTCCTCTCTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-335s1c1
Sequence:CCGGGACCACAATTTCCATCCAGTTCTCGAGAACTGGATGGAAATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027898.2-1472s1c1
Sequence:CCGGCGAAGATTATTTCCACCACCTCTCGAGAGGTGGTGGAAATAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027898.2-2227s1c1
Sequence:CCGGCATAGAACCAAGATGCACTTTCTCGAGAAAGTGCATCTTGGTTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-1385s1c1
Sequence:CCGGGCTTCGTGTATCCTCAGAGATCTCGAGATCTCTGAGGATACACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-192s1c1
Sequence:CCGGCGGAAACTGTTCAGCAAACTTCTCGAGAAGTTTGCTGAACAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027898.3-2241s21c1
Sequence:CCGGGAAGCTACATCAAGGAATTACCTCGAGGTAATTCCTTGATGTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-462s21c1
Sequence:CCGGAGAGCGCCTCATCGTGGATTACTCGAGTAATCCACGATGAGGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027898.3-2465s21c1
Sequence:CCGGCATAGAACCAAGATGCACTTTCTCGAGAAAGTGCATCTTGGTTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-565s21c1
Sequence:CCGGTTCCGCTGGGAGACCACAATTCTCGAGAATTGTGGTCTCCCAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-1177s21c1
Sequence:CCGGCTATTGACAGACACGAGTAACCTCGAGGTTACTCGTGTCTGTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027898
VALIDATED
GRAMD1A MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 1A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-923s1c1
Sequence:CCGGGCTGTCTAGAGAGGAACTATTCTCGAGAATAGTTCCTCTCTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-335s1c1
Sequence:CCGGGACCACAATTTCCATCCAGTTCTCGAGAACTGGATGGAAATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027898.2-1472s1c1
Sequence:CCGGCGAAGATTATTTCCACCACCTCTCGAGAGGTGGTGGAAATAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027898.2-2227s1c1
Sequence:CCGGCATAGAACCAAGATGCACTTTCTCGAGAAAGTGCATCTTGGTTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-1385s1c1
Sequence:CCGGGCTTCGTGTATCCTCAGAGATCTCGAGATCTCTGAGGATACACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027898.2-192s1c1
Sequence:CCGGCGGAAACTGTTCAGCAAACTTCTCGAGAAGTTTGCTGAACAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027898.3-2241s21c1
Sequence:CCGGGAAGCTACATCAAGGAATTACCTCGAGGTAATTCCTTGATGTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-462s21c1
Sequence:CCGGAGAGCGCCTCATCGTGGATTACTCGAGTAATCCACGATGAGGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027898.3-2465s21c1
Sequence:CCGGCATAGAACCAAGATGCACTTTCTCGAGAAAGTGCATCTTGGTTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-565s21c1
Sequence:CCGGTTCCGCTGGGAGACCACAATTCTCGAGAATTGTGGTCTCCCAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027898.3-1177s21c1
Sequence:CCGGCTATTGACAGACACGAGTAACCTCGAGGTTACTCGTGTCTGTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks