EMAIL THIS PAGE TO A FRIEND

GRAMD1B

GRAM domain containing 1B

194 Gene Product Result for
UniProtKB ID: Q3KR37, Q6UW85, Q9ULL9
Gene ID:
Mouse(235283) GRAM domain containing 1B
Rat(300644) GRAM domain containing 1B
domestic guinea pig(100720889) GRAM domain containing 1B
naked mole-rat(101703845) GRAM domain containing 1B
sheep(101118986) GRAM domain containing 1B
Zebrafish(100332318) GRAM domain containing 1B
chicken(769528) GRAM domain containing 1B
dog(489352) GRAM domain containing 1B
cow(517332) GRAM domain containing 1B
Horse(100063638) GRAM domain containing 1B
domestic cat(101092289) GRAM domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020716 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027021 MISSION® esiRNA esiRNA human GRAMD1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020716 Rosetta Predictions human pricing
XM_001059472 Rosetta Predictions rat pricing
XM_217113 Rosetta Predictions rat pricing
NM_172768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353733 predicted 1945
2 SASI_Hs02_00353734 predicted 658
3 SASI_Hs02_00353735 predicted 650
4 SASI_Hs02_00353736 predicted 2367
5 SASI_Hs02_00353737 predicted 920
6 SASI_Hs02_00353738 predicted 1048
7 SASI_Hs02_00353739 predicted 2252
8 SASI_Hs02_00353740 predicted 974
9 SASI_Hs02_00353741 predicted 1754
10 SASI_Hs02_00353742 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293345 predicted 1383
2 SASI_Rn02_00293346 predicted 2108
3 SASI_Rn02_00293347 predicted 218
4 SASI_Rn02_00293348 predicted 2139
5 SASI_Rn02_00293349 predicted 1948
6 SASI_Rn02_00293350 predicted 2545
7 SASI_Rn02_00293351 predicted 1418
8 SASI_Rn02_00293352 predicted 1815
9 SASI_Rn02_00293353 predicted 1800
10 SASI_Rn02_00293354 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377000 predicted 1379
2 SASI_Rn02_00377001 predicted 2107
3 SASI_Rn02_00377002 predicted 214
4 SASI_Rn02_00377003 predicted 2140
5 SASI_Rn02_00377004 predicted 1949
6 SASI_Rn02_00377005 predicted 2546
7 SASI_Rn02_00377006 predicted 1416
8 SASI_Rn02_00377007 predicted 1806
9 SASI_Rn02_00377008 predicted 1799
10 SASI_Rn02_00377009 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032873 predicted 785
2 SASI_Mm01_00032874 predicted 2139
3 SASI_Mm01_00032875 predicted 215
4 SASI_Mm01_00032877 predicted 1640
5 SASI_Mm01_00032878 predicted 2106
6 SASI_Mm02_00344645 predicted 1667
7 SASI_Mm01_00032879 predicted 794
8 SASI_Mm01_00032880 predicted 533
9 SASI_Mm01_00032881 predicted 1117
10 SASI_Mm01_00032882 predicted 1409
11 SASI_Mm01_00032876 predicted 1963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172768
GRAMD1B MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 1B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-1791s21c1
Sequence:CCGGGAAACCAGAGTCGAGTGATTCCTCGAGGAATCACTCGACTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-542s21c1
Sequence:CCGGGACGAAAGCACTGCCAGTAACCTCGAGGTTACTGGCAGTGCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-2099s21c1
Sequence:CCGGGAGGACTACTTCCGTCATTTACTCGAGTAAATGACGGAAGTAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-791s1c1
Sequence:CCGGCCCACTTACAAGCAGAGAAATCTCGAGATTTCTCTGCTTGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-855s1c1
Sequence:CCGGGCCTCATTGTTGATTACTCTTCTCGAGAAGAGTAATCAACAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-2446s1c1
Sequence:CCGGGCTCTTCTACAAGCTGTGGATCTCGAGATCCACAGCTTGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172768.1-2641s1c1
Sequence:CCGGGATGAAGGACTCGCTTATCAACTCGAGTTGATAAGCGAGTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-2650s1c1
Sequence:CCGGCTCGCTTATCAATCTTCAGAACTCGAGTTCTGAAGATTGATAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-1096s1c1
Sequence:CCGGCAGGACGTACATGATGATGTTCTCGAGAACATCATCATGTACGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172768
GRAMD1B MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 1B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-1791s21c1
Sequence:CCGGGAAACCAGAGTCGAGTGATTCCTCGAGGAATCACTCGACTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-542s21c1
Sequence:CCGGGACGAAAGCACTGCCAGTAACCTCGAGGTTACTGGCAGTGCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-2099s21c1
Sequence:CCGGGAGGACTACTTCCGTCATTTACTCGAGTAAATGACGGAAGTAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-791s1c1
Sequence:CCGGCCCACTTACAAGCAGAGAAATCTCGAGATTTCTCTGCTTGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-855s1c1
Sequence:CCGGGCCTCATTGTTGATTACTCTTCTCGAGAAGAGTAATCAACAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-2446s1c1
Sequence:CCGGGCTCTTCTACAAGCTGTGGATCTCGAGATCCACAGCTTGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172768.1-2641s1c1
Sequence:CCGGGATGAAGGACTCGCTTATCAACTCGAGTTGATAAGCGAGTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-2650s1c1
Sequence:CCGGCTCGCTTATCAATCTTCAGAACTCGAGTTCTGAAGATTGATAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-1096s1c1
Sequence:CCGGCAGGACGTACATGATGATGTTCTCGAGAACATCATCATGTACGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172768
GRAMD1B MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 1B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-1791s21c1
Sequence:CCGGGAAACCAGAGTCGAGTGATTCCTCGAGGAATCACTCGACTCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-542s21c1
Sequence:CCGGGACGAAAGCACTGCCAGTAACCTCGAGGTTACTGGCAGTGCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172768.1-2099s21c1
Sequence:CCGGGAGGACTACTTCCGTCATTTACTCGAGTAAATGACGGAAGTAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-791s1c1
Sequence:CCGGCCCACTTACAAGCAGAGAAATCTCGAGATTTCTCTGCTTGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-855s1c1
Sequence:CCGGGCCTCATTGTTGATTACTCTTCTCGAGAAGAGTAATCAACAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-2446s1c1
Sequence:CCGGGCTCTTCTACAAGCTGTGGATCTCGAGATCCACAGCTTGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172768.1-2641s1c1
Sequence:CCGGGATGAAGGACTCGCTTATCAACTCGAGTTGATAAGCGAGTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-2650s1c1
Sequence:CCGGCTCGCTTATCAATCTTCAGAACTCGAGTTCTGAAGATTGATAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172768.1-1096s1c1
Sequence:CCGGCAGGACGTACATGATGATGTTCTCGAGAACATCATCATGTACGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020716
VALIDATED
GRAMD1B MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020716.1-1756s21c1
Sequence:CCGGACTACTTCTACACAATCAATCCTCGAGGATTGATTGTGTAGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-1902s21c1
Sequence:CCGGGAGGACTACTTCCGCCATTTACTCGAGTAAATGGCGGAAGTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-2587s21c1
Sequence:CCGGCATGTACATAGACCATATAAACTCGAGTTTATATGGTCTATGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-1699s21c1
Sequence:CCGGAGAGTGAATGTTACGTGATAGCTCGAGCTATCACGTAACATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-833s21c1
Sequence:CCGGTCCCAATGCCATCCAAGTTTGCTCGAGCAAACTTGGATGGCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020716
VALIDATED
GRAMD1B MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020716.1-1756s21c1
Sequence:CCGGACTACTTCTACACAATCAATCCTCGAGGATTGATTGTGTAGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-1902s21c1
Sequence:CCGGGAGGACTACTTCCGCCATTTACTCGAGTAAATGGCGGAAGTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-2587s21c1
Sequence:CCGGCATGTACATAGACCATATAAACTCGAGTTTATATGGTCTATGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-1699s21c1
Sequence:CCGGAGAGTGAATGTTACGTGATAGCTCGAGCTATCACGTAACATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-833s21c1
Sequence:CCGGTCCCAATGCCATCCAAGTTTGCTCGAGCAAACTTGGATGGCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020716
VALIDATED
GRAMD1B MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020716.1-1756s21c1
Sequence:CCGGACTACTTCTACACAATCAATCCTCGAGGATTGATTGTGTAGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-1902s21c1
Sequence:CCGGGAGGACTACTTCCGCCATTTACTCGAGTAAATGGCGGAAGTAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-2587s21c1
Sequence:CCGGCATGTACATAGACCATATAAACTCGAGTTTATATGGTCTATGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-1699s21c1
Sequence:CCGGAGAGTGAATGTTACGTGATAGCTCGAGCTATCACGTAACATTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020716.1-833s21c1
Sequence:CCGGTCCCAATGCCATCCAAGTTTGCTCGAGCAAACTTGGATGGCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks