EMAIL THIS PAGE TO A FRIEND

GRAMD1C

GRAM domain containing 1C

70 Gene Product Result for
UniProtKB ID: Q8IYS0, A8K9Y1, Q6AW94, Q6UWN1, Q8N6S0, Q9UF46
Gene ID:
Mouse(207798) GRAM domain containing 1C
Rat(360717) GRAM domain containing 1C
Zebrafish(553007) GRAM domain containing 1c
chicken(418354) GRAM domain containing 1C
domestic cat(101091965) GRAM domain containing 1C
cow(505581) GRAM domain containing 1C
Horse(100071350) GRAM domain containing 1C
dog(607747) GRAM domain containing 1C
sheep(101116013) GRAM domain containing 1C
Domestic Rabbit(100344169) GRAM domain containing 1C
domestic guinea pig(100714946) GRAM domain containing 1C
naked mole-rat(101696780) GRAM domain containing 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012316 Anti-GRAMD1C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017577 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017577 Rosetta Predictions human pricing
XM_001067592 Rosetta Predictions rat pricing
XM_340988 Rosetta Predictions rat pricing
NM_153528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076010 predicted 972
2 SASI_Hs01_00076011 predicted 568
3 SASI_Hs01_00076012 predicted 1111
4 SASI_Hs02_00350234 predicted 406
5 SASI_Hs02_00350235 predicted 806
6 SASI_Hs01_00076014 predicted 1224
7 SASI_Hs01_00076017 predicted 1511
8 SASI_Hs02_00350236 predicted 305
9 SASI_Hs02_00350237 predicted 1882
10 SASI_Hs01_00076018 predicted 1291
11 SASI_Hs01_00076009 predicted 2157
12 SASI_Hs01_00076013 predicted 269
13 SASI_Hs01_00076015 predicted 336
14 SASI_Hs01_00076016 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321514 predicted 494
2 SASI_Rn02_00321515 predicted 1135
3 SASI_Rn02_00321516 predicted 1363
4 SASI_Rn02_00321517 predicted 793
5 SASI_Rn02_00321518 predicted 808
6 SASI_Rn02_00321519 predicted 1526
7 SASI_Rn02_00321520 predicted 217
8 SASI_Rn02_00321521 predicted 1223
9 SASI_Rn02_00321522 predicted 696
10 SASI_Rn02_00321523 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392230 predicted 494
2 SASI_Rn02_00392231 predicted 434
3 SASI_Rn02_00392232 predicted 343
4 SASI_Rn02_00392233 predicted 208
5 SASI_Rn02_00392234 predicted 466
6 SASI_Rn02_00392235 predicted 343
7 SASI_Rn02_00392236 predicted 212
8 SASI_Rn02_00392237 predicted 695
9 SASI_Rn02_00392238 predicted 693
10 SASI_Rn02_00392239 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071403 predicted 1046
2 SASI_Mm01_00071404 predicted 1001
3 SASI_Mm01_00071405 predicted 1096
4 SASI_Mm01_00071406 predicted 1126
5 SASI_Mm01_00071407 predicted 1645
6 SASI_Mm01_00071408 predicted 804
7 SASI_Mm02_00343293 predicted 1748
8 SASI_Mm01_00071409 predicted 470
9 SASI_Mm01_00071410 predicted 458
10 SASI_Mm01_00071411 predicted 970
11 SASI_Mm01_00071412 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153528
GRAMD1C MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 1C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-781s1c1
Sequence:CCGGGTTCACTAGCTCACACTTTATCTCGAGATAAAGTGTGAGCTAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-728s1c1
Sequence:CCGGCTTTATATCAACCGTGTCTTTCTCGAGAAAGACACGGTTGATATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-1030s1c1
Sequence:CCGGCGACTACTTCTACACTTTGAACTCGAGTTCAAAGTGTAGAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-1359s1c1
Sequence:CCGGCCAAAGTAGATGTTACAGGAACTCGAGTTCCTGTAACATCTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-1624s1c1
Sequence:CCGGCCAAGATTCCATAGTGATGTTCTCGAGAACATCACTATGGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153528.1-2311s1c1
Sequence:CCGGGCCATGTTGTATCTGAATGAACTCGAGTTCATTCAGATACAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-556s1c1
Sequence:CCGGGAGCGAGAGAAATGTGAGAAACTCGAGTTTCTCACATTTCTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-778s1c1
Sequence:CCGGGCTGTTCACTAGCTCACACTTCTCGAGAAGTGTGAGCTAGTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153528.1-2482s1c1
Sequence:CCGGATAGGACATCAATGCTCATAACTCGAGTTATGAGCATTGATGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-1397s1c1
Sequence:CCGGAGTTATGACACCGCCCTTATTCTCGAGAATAAGGGCGGTGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153528
GRAMD1C MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 1C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-781s1c1
Sequence:CCGGGTTCACTAGCTCACACTTTATCTCGAGATAAAGTGTGAGCTAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-728s1c1
Sequence:CCGGCTTTATATCAACCGTGTCTTTCTCGAGAAAGACACGGTTGATATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-1030s1c1
Sequence:CCGGCGACTACTTCTACACTTTGAACTCGAGTTCAAAGTGTAGAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-1359s1c1
Sequence:CCGGCCAAAGTAGATGTTACAGGAACTCGAGTTCCTGTAACATCTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-1624s1c1
Sequence:CCGGCCAAGATTCCATAGTGATGTTCTCGAGAACATCACTATGGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153528.1-2311s1c1
Sequence:CCGGGCCATGTTGTATCTGAATGAACTCGAGTTCATTCAGATACAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-556s1c1
Sequence:CCGGGAGCGAGAGAAATGTGAGAAACTCGAGTTTCTCACATTTCTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-778s1c1
Sequence:CCGGGCTGTTCACTAGCTCACACTTCTCGAGAAGTGTGAGCTAGTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153528.1-2482s1c1
Sequence:CCGGATAGGACATCAATGCTCATAACTCGAGTTATGAGCATTGATGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-1397s1c1
Sequence:CCGGAGTTATGACACCGCCCTTATTCTCGAGAATAAGGGCGGTGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153528
GRAMD1C MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 1C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-781s1c1
Sequence:CCGGGTTCACTAGCTCACACTTTATCTCGAGATAAAGTGTGAGCTAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-728s1c1
Sequence:CCGGCTTTATATCAACCGTGTCTTTCTCGAGAAAGACACGGTTGATATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-1030s1c1
Sequence:CCGGCGACTACTTCTACACTTTGAACTCGAGTTCAAAGTGTAGAAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-1359s1c1
Sequence:CCGGCCAAAGTAGATGTTACAGGAACTCGAGTTCCTGTAACATCTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-1624s1c1
Sequence:CCGGCCAAGATTCCATAGTGATGTTCTCGAGAACATCACTATGGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153528.1-2311s1c1
Sequence:CCGGGCCATGTTGTATCTGAATGAACTCGAGTTCATTCAGATACAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153528.1-556s1c1
Sequence:CCGGGAGCGAGAGAAATGTGAGAAACTCGAGTTTCTCACATTTCTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-778s1c1
Sequence:CCGGGCTGTTCACTAGCTCACACTTCTCGAGAAGTGTGAGCTAGTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153528.1-2482s1c1
Sequence:CCGGATAGGACATCAATGCTCATAACTCGAGTTATGAGCATTGATGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153528.1-1397s1c1
Sequence:CCGGAGTTATGACACCGCCCTTATTCTCGAGAATAAGGGCGGTGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017577
VALIDATED
GRAMD1C MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 1C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-1576s1c1
Sequence:CCGGCCATGATTACTTCTATACCGTCTCGAGACGGTATAGAAGTAATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-1594s1c1
Sequence:CCGGCGTGAACAGATACTGTATCATCTCGAGATGATACAGTATCTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-2200s1c1
Sequence:CCGGGCTGAAGAGCTCACTCATTATCTCGAGATAATGAGTGAGCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1214s21c1
Sequence:CCGGAGAACGATGACCTACACTATACTCGAGTATAGTGTAGGTCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-182s21c1
Sequence:CCGGGAGAATAATGTGGTAGTTAAACTCGAGTTTAACTACCACATTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1927s21c1
Sequence:CCGGAGATCAGGCCCATCGTTTAAACTCGAGTTTAAACGATGGGCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1114s21c1
Sequence:CCGGCTTTACCAGTTCACGCTTTATCTCGAGATAAAGCGTGAACTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-3524s21c1
Sequence:CCGGAGCAAGAATGAGTGGATTATACTCGAGTATAATCCACTCATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017577
VALIDATED
GRAMD1C MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 1C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-1576s1c1
Sequence:CCGGCCATGATTACTTCTATACCGTCTCGAGACGGTATAGAAGTAATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-1594s1c1
Sequence:CCGGCGTGAACAGATACTGTATCATCTCGAGATGATACAGTATCTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-2200s1c1
Sequence:CCGGGCTGAAGAGCTCACTCATTATCTCGAGATAATGAGTGAGCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1214s21c1
Sequence:CCGGAGAACGATGACCTACACTATACTCGAGTATAGTGTAGGTCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-182s21c1
Sequence:CCGGGAGAATAATGTGGTAGTTAAACTCGAGTTTAACTACCACATTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1927s21c1
Sequence:CCGGAGATCAGGCCCATCGTTTAAACTCGAGTTTAAACGATGGGCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1114s21c1
Sequence:CCGGCTTTACCAGTTCACGCTTTATCTCGAGATAAAGCGTGAACTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-3524s21c1
Sequence:CCGGAGCAAGAATGAGTGGATTATACTCGAGTATAATCCACTCATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017577
VALIDATED
GRAMD1C MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 1C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-1576s1c1
Sequence:CCGGCCATGATTACTTCTATACCGTCTCGAGACGGTATAGAAGTAATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-1594s1c1
Sequence:CCGGCGTGAACAGATACTGTATCATCTCGAGATGATACAGTATCTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017577.1-2200s1c1
Sequence:CCGGGCTGAAGAGCTCACTCATTATCTCGAGATAATGAGTGAGCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1214s21c1
Sequence:CCGGAGAACGATGACCTACACTATACTCGAGTATAGTGTAGGTCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-182s21c1
Sequence:CCGGGAGAATAATGTGGTAGTTAAACTCGAGTTTAACTACCACATTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1927s21c1
Sequence:CCGGAGATCAGGCCCATCGTTTAAACTCGAGTTTAAACGATGGGCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-1114s21c1
Sequence:CCGGCTTTACCAGTTCACGCTTTATCTCGAGATAAAGCGTGAACTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017577.4-3524s21c1
Sequence:CCGGAGCAAGAATGAGTGGATTATACTCGAGTATAATCCACTCATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks