EMAIL THIS PAGE TO A FRIEND

GRAMD2

GRAM domain containing 2

59 Gene Product Result for
UniProtKB ID: Q8IUY3, B3KT68
Gene ID:
Mouse(546134) GRAM domain containing 2
Rat(300761) GRAM domain containing 2
domestic guinea pig(100715548) GRAM domain containing 2
naked mole-rat(101722115) GRAM domain containing 2
sheep(101115544) GRAM domain containing 2
chicken(101748322) GRAM domain containing 2
cow(100300494) GRAM domain containing 2
domestic cat(101096733) GRAM domain containing 2
dog(611282) GRAM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100968 Anti-GRAMD2 antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, rat, guinea pig, horse
western blot pricing
HPA029435 Anti-GRAMD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012642 Rosetta Predictions human pricing
XM_001073229 Rosetta Predictions rat pricing
XM_217153 Rosetta Predictions rat pricing
NM_001033498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306198 predicted 1005
2 SASI_Hs01_00020732 predicted 479
3 SASI_Hs01_00020733 predicted 683
4 SASI_Hs01_00020734 predicted 1143
5 SASI_Hs01_00020735 predicted 1025
6 SASI_Hs01_00020736 predicted 564
7 SASI_Hs01_00020737 predicted 218
8 SASI_Hs01_00020738 predicted 241
9 SASI_Hs01_00020739 predicted 561
10 SASI_Hs01_00020740 predicted 1120
11 SASI_Hs01_00020731 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341976 predicted 989
2 SASI_Rn02_00341977 predicted 681
3 SASI_Rn02_00341978 predicted 741
4 SASI_Rn02_00341979 predicted 371
5 SASI_Rn02_00341980 predicted 1010
6 SASI_Rn02_00341981 predicted 270
7 SASI_Rn02_00341982 predicted 575
8 SASI_Rn02_00341983 predicted 859
9 SASI_Rn02_00341984 predicted 1146
10 SASI_Rn02_00341985 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377030 predicted 997
2 SASI_Rn02_00377031 predicted 679
3 SASI_Rn02_00377032 predicted 848
4 SASI_Rn02_00377033 predicted 738
5 SASI_Rn02_00377034 predicted 1005
6 SASI_Rn02_00377035 predicted 578
7 SASI_Rn02_00377036 predicted 857
8 SASI_Rn02_00377037 predicted 1142
9 SASI_Rn02_00377038 predicted 796
10 SASI_Rn02_00377039 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109834 predicted 1093
2 SASI_Mm01_00109835 predicted 1007
3 SASI_Mm02_00288868 predicted 393
4 SASI_Mm01_00109837 predicted 510
5 SASI_Mm01_00109838 predicted 1086
6 SASI_Mm01_00109839 predicted 217
7 SASI_Mm01_00109840 predicted 1065
8 SASI_Mm01_00109841 predicted 267
9 SASI_Mm01_00109842 predicted 424
10 SASI_Mm01_00109843 predicted 578
11 SASI_Mm01_00109836 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033498
GRAMD2 MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033498.1-1165s21c1
Sequence:CCGGGGTCTTCATCCCACACCTTATCTCGAGATAAGGTGTGGGATGAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-387s21c1
Sequence:CCGGAGGGACACTACGGAGCAAATACTCGAGTATTTGCTCCGTAGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-748s21c1
Sequence:CCGGAGCAAGAAGAGTCTGAGTATACTCGAGTATACTCAGACTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-560s21c1
Sequence:CCGGAGGATATCAAGGTGGTCATTCCTCGAGGAATGACCACCTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-497s21c1
Sequence:CCGGTTCTCCATGGTCGGCTCTATACTCGAGTATAGAGCCGACCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033498
GRAMD2 MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033498.1-1165s21c1
Sequence:CCGGGGTCTTCATCCCACACCTTATCTCGAGATAAGGTGTGGGATGAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-387s21c1
Sequence:CCGGAGGGACACTACGGAGCAAATACTCGAGTATTTGCTCCGTAGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-748s21c1
Sequence:CCGGAGCAAGAAGAGTCTGAGTATACTCGAGTATACTCAGACTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-560s21c1
Sequence:CCGGAGGATATCAAGGTGGTCATTCCTCGAGGAATGACCACCTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-497s21c1
Sequence:CCGGTTCTCCATGGTCGGCTCTATACTCGAGTATAGAGCCGACCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033498
GRAMD2 MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033498.1-1165s21c1
Sequence:CCGGGGTCTTCATCCCACACCTTATCTCGAGATAAGGTGTGGGATGAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-387s21c1
Sequence:CCGGAGGGACACTACGGAGCAAATACTCGAGTATTTGCTCCGTAGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-748s21c1
Sequence:CCGGAGCAAGAAGAGTCTGAGTATACTCGAGTATACTCAGACTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-560s21c1
Sequence:CCGGAGGATATCAAGGTGGTCATTCCTCGAGGAATGACCACCTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033498.1-497s21c1
Sequence:CCGGTTCTCCATGGTCGGCTCTATACTCGAGTATAGAGCCGACCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012642
GRAMD2 MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012642.1-626s1c1
Sequence:CCGGCCCTGAGATGAAGTGGAGAAACTCGAGTTTCTCCACTTCATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012642.1-2423s1c1
Sequence:CCGGCCAGAAGTATCAGGGAAAGTTCTCGAGAACTTTCCCTGATACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-374s1c1
Sequence:CCGGCAAGGATATCAAGGTGGTCATCTCGAGATGACCACCTTGATATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012642.1-2834s1c1
Sequence:CCGGCCTTGCTGAAAGACAGAGATACTCGAGTATCTCTGTCTTTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-953s1c1
Sequence:CCGGCAAGGTCTTCTTTGTGCTGATCTCGAGATCAGCACAAAGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012642.1-2567s1c1
Sequence:CCGGCCTGTTTATGACAAACCCAAACTCGAGTTTGGGTTTGTCATAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-565s1c1
Sequence:CCGGGCAAGAAGAGTCTGAGTGTAACTCGAGTTACACTCAGACTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012642
GRAMD2 MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012642.1-626s1c1
Sequence:CCGGCCCTGAGATGAAGTGGAGAAACTCGAGTTTCTCCACTTCATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012642.1-2423s1c1
Sequence:CCGGCCAGAAGTATCAGGGAAAGTTCTCGAGAACTTTCCCTGATACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-374s1c1
Sequence:CCGGCAAGGATATCAAGGTGGTCATCTCGAGATGACCACCTTGATATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012642.1-2834s1c1
Sequence:CCGGCCTTGCTGAAAGACAGAGATACTCGAGTATCTCTGTCTTTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-953s1c1
Sequence:CCGGCAAGGTCTTCTTTGTGCTGATCTCGAGATCAGCACAAAGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012642.1-2567s1c1
Sequence:CCGGCCTGTTTATGACAAACCCAAACTCGAGTTTGGGTTTGTCATAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-565s1c1
Sequence:CCGGGCAAGAAGAGTCTGAGTGTAACTCGAGTTACACTCAGACTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012642
GRAMD2 MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012642.1-626s1c1
Sequence:CCGGCCCTGAGATGAAGTGGAGAAACTCGAGTTTCTCCACTTCATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012642.1-2423s1c1
Sequence:CCGGCCAGAAGTATCAGGGAAAGTTCTCGAGAACTTTCCCTGATACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-374s1c1
Sequence:CCGGCAAGGATATCAAGGTGGTCATCTCGAGATGACCACCTTGATATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012642.1-2834s1c1
Sequence:CCGGCCTTGCTGAAAGACAGAGATACTCGAGTATCTCTGTCTTTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-953s1c1
Sequence:CCGGCAAGGTCTTCTTTGTGCTGATCTCGAGATCAGCACAAAGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012642.1-2567s1c1
Sequence:CCGGCCTGTTTATGACAAACCCAAACTCGAGTTTGGGTTTGTCATAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012642.1-565s1c1
Sequence:CCGGGCAAGAAGAGTCTGAGTGTAACTCGAGTTACACTCAGACTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks