EMAIL THIS PAGE TO A FRIEND

GRAMD3

GRAM domain containing 3

141 Gene Product Result for
Synonyms: NS3TP2
Gene ID:
Mouse(107022) GRAM domain containing 3
Rat(307288) GRAM domain containing 3
chicken(426813) GRAM domain containing 3
cow(505627) GRAM domain containing 3
Horse(100063823) GRAM domain containing 3
domestic cat(101086034) GRAM domain containing 3
dog(474662) GRAM domain containing 3
sheep(101108384) GRAM domain containing 3
domestic guinea pig(100732513) GRAM domain containing 3
naked mole-rat(101712518) GRAM domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023927 Rosetta Predictions human pricing
NM_001014011 Rosetta Predictions rat pricing
NM_026240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039442 predicted 1336
2 SASI_Hs01_00039444 predicted 1380
3 SASI_Hs02_00356386 predicted 286
4 SASI_Hs01_00039445 predicted 744
5 SASI_Hs02_00356387 predicted 1290
6 SASI_Hs01_00039448 predicted 988
7 SASI_Hs01_00039449 predicted 422
8 SASI_Hs01_00039450 predicted 982
9 SASI_Hs02_00356388 predicted 1257
10 SASI_Hs02_00356389 predicted 607
11 SASI_Hs01_00039441 predicted 808
12 SASI_Hs01_00039443 predicted 778
13 SASI_Hs01_00039446 predicted 1501
14 SASI_Hs01_00039447 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081555 predicted 340
2 SASI_Rn01_00081556 predicted 1299
3 SASI_Rn01_00081557 predicted 646
4 SASI_Rn01_00081558 predicted 1460
5 SASI_Rn02_00201391 predicted 475
6 SASI_Rn01_00081559 predicted 309
7 SASI_Rn01_00081560 predicted 491
8 SASI_Rn01_00081562 predicted 935
9 SASI_Rn01_00081563 predicted 835
10 SASI_Rn01_00081564 predicted 708
11 SASI_Rn01_00081561 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046306 predicted 410
2 SASI_Mm01_00046307 predicted 721
3 SASI_Mm01_00046308 predicted 630
4 SASI_Mm01_00046309 predicted 1191
5 SASI_Mm01_00046310 predicted 980
6 SASI_Mm01_00046311 predicted 521
7 SASI_Mm01_00046313 predicted 555
8 SASI_Mm01_00046314 predicted 1370
9 SASI_Mm02_00329923 predicted 753
10 SASI_Mm02_00329924 predicted 697
11 SASI_Mm01_00046312 predicted 798
12 SASI_Mm01_00046315 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023927
VALIDATED
GRAMD3 MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023927.1-1042s1c1
Sequence:CCGGCGAGATTTCCATGCGACAGAACTCGAGTTCTGTCGCATGGAAATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023927.1-1601s1c1
Sequence:CCGGGCAGATGAGAATCCAGACATTCTCGAGAATGTCTGGATTCTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023927.1-1516s1c1
Sequence:CCGGCCATCGGAATACCTCATGTTTCTCGAGAAACATGAGGTATTCCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_023927.1-2035s1c1
Sequence:CCGGCCTGTTATGTTCTGGTTGAAACTCGAGTTTCAACCAGAACATAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023927.1-1173s1c1
Sequence:CCGGGTCAGAAACTGTTGGAATCTTCTCGAGAAGATTCCAACAGTTTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023927.1-1064s1c1
Sequence:CCGGCCCAAACAGTTCTGAATGTCTCTCGAGAGACATTCAGAACTGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_023927.1-1772s1c1
Sequence:CCGGCGAACACACTCTCTTGGATAACTCGAGTTATCCAAGAGAGTGTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023927.1-1771s1c1
Sequence:CCGGGCGAACACACTCTCTTGGATACTCGAGTATCCAAGAGAGTGTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023927.1-1515s1c1
Sequence:CCGGGCCATCGGAATACCTCATGTTCTCGAGAACATGAGGTATTCCGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023927
VALIDATED
GRAMD3 MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023927.1-1042s1c1
Sequence:CCGGCGAGATTTCCATGCGACAGAACTCGAGTTCTGTCGCATGGAAATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023927.1-1601s1c1
Sequence:CCGGGCAGATGAGAATCCAGACATTCTCGAGAATGTCTGGATTCTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023927.1-1516s1c1
Sequence:CCGGCCATCGGAATACCTCATGTTTCTCGAGAAACATGAGGTATTCCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_023927.1-2035s1c1
Sequence:CCGGCCTGTTATGTTCTGGTTGAAACTCGAGTTTCAACCAGAACATAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023927.1-1173s1c1
Sequence:CCGGGTCAGAAACTGTTGGAATCTTCTCGAGAAGATTCCAACAGTTTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023927.1-1064s1c1
Sequence:CCGGCCCAAACAGTTCTGAATGTCTCTCGAGAGACATTCAGAACTGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_023927.1-1772s1c1
Sequence:CCGGCGAACACACTCTCTTGGATAACTCGAGTTATCCAAGAGAGTGTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023927.1-1771s1c1
Sequence:CCGGGCGAACACACTCTCTTGGATACTCGAGTATCCAAGAGAGTGTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023927.1-1515s1c1
Sequence:CCGGGCCATCGGAATACCTCATGTTCTCGAGAACATGAGGTATTCCGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023927
VALIDATED
GRAMD3 MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023927.1-1042s1c1
Sequence:CCGGCGAGATTTCCATGCGACAGAACTCGAGTTCTGTCGCATGGAAATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023927.1-1601s1c1
Sequence:CCGGGCAGATGAGAATCCAGACATTCTCGAGAATGTCTGGATTCTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023927.1-1516s1c1
Sequence:CCGGCCATCGGAATACCTCATGTTTCTCGAGAAACATGAGGTATTCCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_023927.1-2035s1c1
Sequence:CCGGCCTGTTATGTTCTGGTTGAAACTCGAGTTTCAACCAGAACATAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023927.1-1173s1c1
Sequence:CCGGGTCAGAAACTGTTGGAATCTTCTCGAGAAGATTCCAACAGTTTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023927.1-1064s1c1
Sequence:CCGGCCCAAACAGTTCTGAATGTCTCTCGAGAGACATTCAGAACTGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_023927.1-1772s1c1
Sequence:CCGGCGAACACACTCTCTTGGATAACTCGAGTTATCCAAGAGAGTGTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023927.1-1771s1c1
Sequence:CCGGGCGAACACACTCTCTTGGATACTCGAGTATCCAAGAGAGTGTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023927.1-1515s1c1
Sequence:CCGGGCCATCGGAATACCTCATGTTCTCGAGAACATGAGGTATTCCGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026240
VALIDATED
GRAMD3 MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1613s1c1
Sequence:CCGGGCCAAGAACTTACAGCTAACACTCGAGTGTTAGCTGTAAGTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1627s1c1
Sequence:CCGGGCTAACATAGTGAAATTGGAACTCGAGTTCCAATTTCACTATGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026240.1-1710s1c1
Sequence:CCGGCCAACATAAATACCTCACGTTCTCGAGAACGTGAGGTATTTATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1423s1c1
Sequence:CCGGCATCACATCCTGATAGTCTATCTCGAGATAGACTATCAGGATGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1614s1c1
Sequence:CCGGCCAAGAACTTACAGCTAACATCTCGAGATGTTAGCTGTAAGTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-1364s21c1
Sequence:CCGGCCAAGAACTTACAGCTAACATCTCGAGATGTTAGCTGTAAGTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-1183s21c1
Sequence:CCGGTGATAGTCTATGCAATTATTGCTCGAGCAATAATTGCATAGACTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-712s21c1
Sequence:CCGGCGGTCACAGACAGGTACATATCTCGAGATATGTACCTGTCTGTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-470s21c1
Sequence:CCGGCATGCACTTTCACAAGTTATTCTCGAGAATAACTTGTGAAAGTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026240.2-1717s21c1
Sequence:CCGGTAGCACGAGGGTTATGGTAATCTCGAGATTACCATAACCCTCGTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026240
VALIDATED
GRAMD3 MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1613s1c1
Sequence:CCGGGCCAAGAACTTACAGCTAACACTCGAGTGTTAGCTGTAAGTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1627s1c1
Sequence:CCGGGCTAACATAGTGAAATTGGAACTCGAGTTCCAATTTCACTATGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026240.1-1710s1c1
Sequence:CCGGCCAACATAAATACCTCACGTTCTCGAGAACGTGAGGTATTTATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1423s1c1
Sequence:CCGGCATCACATCCTGATAGTCTATCTCGAGATAGACTATCAGGATGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1614s1c1
Sequence:CCGGCCAAGAACTTACAGCTAACATCTCGAGATGTTAGCTGTAAGTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-1364s21c1
Sequence:CCGGCCAAGAACTTACAGCTAACATCTCGAGATGTTAGCTGTAAGTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-1183s21c1
Sequence:CCGGTGATAGTCTATGCAATTATTGCTCGAGCAATAATTGCATAGACTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-712s21c1
Sequence:CCGGCGGTCACAGACAGGTACATATCTCGAGATATGTACCTGTCTGTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-470s21c1
Sequence:CCGGCATGCACTTTCACAAGTTATTCTCGAGAATAACTTGTGAAAGTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026240.2-1717s21c1
Sequence:CCGGTAGCACGAGGGTTATGGTAATCTCGAGATTACCATAACCCTCGTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026240
VALIDATED
GRAMD3 MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1613s1c1
Sequence:CCGGGCCAAGAACTTACAGCTAACACTCGAGTGTTAGCTGTAAGTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1627s1c1
Sequence:CCGGGCTAACATAGTGAAATTGGAACTCGAGTTCCAATTTCACTATGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026240.1-1710s1c1
Sequence:CCGGCCAACATAAATACCTCACGTTCTCGAGAACGTGAGGTATTTATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1423s1c1
Sequence:CCGGCATCACATCCTGATAGTCTATCTCGAGATAGACTATCAGGATGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026240.1-1614s1c1
Sequence:CCGGCCAAGAACTTACAGCTAACATCTCGAGATGTTAGCTGTAAGTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-1364s21c1
Sequence:CCGGCCAAGAACTTACAGCTAACATCTCGAGATGTTAGCTGTAAGTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-1183s21c1
Sequence:CCGGTGATAGTCTATGCAATTATTGCTCGAGCAATAATTGCATAGACTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-712s21c1
Sequence:CCGGCGGTCACAGACAGGTACATATCTCGAGATATGTACCTGTCTGTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026240.2-470s21c1
Sequence:CCGGCATGCACTTTCACAAGTTATTCTCGAGAATAACTTGTGAAAGTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026240.2-1717s21c1
Sequence:CCGGTAGCACGAGGGTTATGGTAATCTCGAGATTACCATAACCCTCGTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)