EMAIL THIS PAGE TO A FRIEND

GRAMD4

GRAM domain containing 4

53 Gene Product Result for
Synonyms: DIP dA59H18.1 dJ439F8.1
UniProtKB ID: Q6IC98, A9IN51, A9IN57, Q68EN0, Q9UGE6, Q9Y4B9
Gene ID:
Human(23151) Summary: GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]
Mouse(223752) GRAM domain containing 4
Rat(315203) GRAM domain containing 4
domestic guinea pig(100723314) GRAM domain containing 4
naked mole-rat(101721454) GRAM domain containing 4
sheep(101111359) GRAM domain containing 4
Zebrafish(558571) GRAM domain containing 4
cow(613430) GRAM domain containing 4
Horse(100049911) GRAM domain containing 4
domestic cat(101096080) GRAM domain containing 4
dog(481202) GRAM domain containing 4
chicken(425953) GRAM domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015124 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015124 Rosetta Predictions human pricing
XM_001078454 Rosetta Predictions rat pricing
XM_235571 Rosetta Predictions rat pricing
NM_172611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066587 predicted 1553
2 SASI_Hs01_00066588 predicted 815
3 SASI_Hs01_00066589 predicted 1560
4 SASI_Hs01_00066590 predicted 1181
5 SASI_Hs01_00066591 predicted 1456
6 SASI_Hs01_00066592 predicted 1364
7 SASI_Hs01_00066593 predicted 1035
8 SASI_Hs01_00066594 predicted 1129
9 SASI_Hs01_00066595 predicted 1505
10 SASI_Hs01_00066596 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360836 predicted 1816
2 SASI_Rn02_00360837 predicted 1261
3 SASI_Rn02_00360838 predicted 1311
4 SASI_Rn02_00360839 predicted 1030
5 SASI_Rn02_00360840 predicted 1910
6 SASI_Rn02_00360841 predicted 1137
7 SASI_Rn02_00360842 predicted 1100
8 SASI_Rn02_00360843 predicted 2131
9 SASI_Rn02_00360844 predicted 1858
10 SASI_Rn02_00360845 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389489 predicted 2382
2 SASI_Rn02_00389490 predicted 2491
3 SASI_Rn02_00389491 predicted 2078
4 SASI_Rn02_00389492 predicted 2155
5 SASI_Rn02_00389493 predicted 2187
6 SASI_Rn02_00389494 predicted 2032
7 SASI_Rn02_00389495 predicted 2403
8 SASI_Rn02_00389496 predicted 2131
9 SASI_Rn02_00389497 predicted 2063
10 SASI_Rn02_00389498 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147895 predicted 1734
2 SASI_Mm01_00147896 predicted 1054
3 SASI_Mm01_00147897 predicted 1609
4 SASI_Mm01_00147898 predicted 1524
5 SASI_Mm01_00147899 predicted 1706
6 SASI_Mm01_00147900 predicted 1990
7 SASI_Mm01_00147902 predicted 425
8 SASI_Mm01_00147903 predicted 821
9 SASI_Mm01_00147904 predicted 1594
10 SASI_Mm02_00344308 predicted 840
11 SASI_Mm01_00147901 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015124
GRAMD4 MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015124.2-1360s21c1
Sequence:CCGGAGCACCAAGAAGGGCAATTTCCTCGAGGAAATTGCCCTTCTTGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015124.2-1842s1c1
Sequence:CCGGCGATTTGGTAGTGGAAACAATCTCGAGATTGTTTCCACTACCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-744s1c1
Sequence:CCGGCATTGCCTTCACCGTGTACATCTCGAGATGTACACGGTGAAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015124.2-1597s1c1
Sequence:CCGGCAGAAGTACAAGGTCCTGTCTCTCGAGAGACAGGACCTTGTACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-678s1c1
Sequence:CCGGGCCGGTCACTAACTTTGTGAACTCGAGTTCACAAAGTTAGTGACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015124.2-996s1c1
Sequence:CCGGCCTGGAGAAGATCAAGAACTTCTCGAGAAGTTCTTGATCTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-787s1c1
Sequence:CCGGGCCATCCCATTGTTCTTATTTCTCGAGAAATAAGAACAATGGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-1384s1c1
Sequence:CCGGGAGATCTTCAATCTGACAGAACTCGAGTTCTGTCAGATTGAAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015124
GRAMD4 MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015124.2-1360s21c1
Sequence:CCGGAGCACCAAGAAGGGCAATTTCCTCGAGGAAATTGCCCTTCTTGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015124.2-1842s1c1
Sequence:CCGGCGATTTGGTAGTGGAAACAATCTCGAGATTGTTTCCACTACCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-744s1c1
Sequence:CCGGCATTGCCTTCACCGTGTACATCTCGAGATGTACACGGTGAAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015124.2-1597s1c1
Sequence:CCGGCAGAAGTACAAGGTCCTGTCTCTCGAGAGACAGGACCTTGTACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-678s1c1
Sequence:CCGGGCCGGTCACTAACTTTGTGAACTCGAGTTCACAAAGTTAGTGACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015124.2-996s1c1
Sequence:CCGGCCTGGAGAAGATCAAGAACTTCTCGAGAAGTTCTTGATCTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-787s1c1
Sequence:CCGGGCCATCCCATTGTTCTTATTTCTCGAGAAATAAGAACAATGGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-1384s1c1
Sequence:CCGGGAGATCTTCAATCTGACAGAACTCGAGTTCTGTCAGATTGAAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015124
GRAMD4 MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015124.2-1360s21c1
Sequence:CCGGAGCACCAAGAAGGGCAATTTCCTCGAGGAAATTGCCCTTCTTGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015124.2-1842s1c1
Sequence:CCGGCGATTTGGTAGTGGAAACAATCTCGAGATTGTTTCCACTACCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-744s1c1
Sequence:CCGGCATTGCCTTCACCGTGTACATCTCGAGATGTACACGGTGAAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015124.2-1597s1c1
Sequence:CCGGCAGAAGTACAAGGTCCTGTCTCTCGAGAGACAGGACCTTGTACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-678s1c1
Sequence:CCGGGCCGGTCACTAACTTTGTGAACTCGAGTTCACAAAGTTAGTGACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015124.2-996s1c1
Sequence:CCGGCCTGGAGAAGATCAAGAACTTCTCGAGAAGTTCTTGATCTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-787s1c1
Sequence:CCGGGCCATCCCATTGTTCTTATTTCTCGAGAAATAAGAACAATGGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015124.2-1384s1c1
Sequence:CCGGGAGATCTTCAATCTGACAGAACTCGAGTTCTGTCAGATTGAAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172611
GRAMD4 MISSION shRNA Bacterial Glycerol Stock
GRAM domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1184s21c1
Sequence:CCGGAGACCACGCAGAAGCTCTATGCTCGAGCATAGAGCTTCTGCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1908s21c1
Sequence:CCGGTGGCGGTGACAGCTAGTATTGCTCGAGCAATACTAGCTGTCACCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1735s21c1
Sequence:CCGGACAGACATCCAGAAGTATAAACTCGAGTTTATACTTCTGGATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172611.2-1983s21c1
Sequence:CCGGCTCGCAGTCTTCGGCAATAATCTCGAGATTATTGCCGAAGACTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1703s21c1
Sequence:CCGGAGAGGAACAAGGTGATCAAACCTCGAGGTTTGATCACCTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172611.1-1782s1c1
Sequence:CCGGGCATGGGAATTGCTGTTTCTACTCGAGTAGAAACAGCAATTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201089    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172611.1-3395s1c1
Sequence:CCGGCCTGGAATATGCTTGTGCTATCTCGAGATAGCACAAGCATATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172611.1-3047s1c1
Sequence:CCGGCCTTCAGATGTCACTGAGATTCTCGAGAATCTCAGTGACATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172611
GRAMD4 MISSION shRNA shRNA Plasmid DNA
GRAM domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1184s21c1
Sequence:CCGGAGACCACGCAGAAGCTCTATGCTCGAGCATAGAGCTTCTGCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1908s21c1
Sequence:CCGGTGGCGGTGACAGCTAGTATTGCTCGAGCAATACTAGCTGTCACCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1735s21c1
Sequence:CCGGACAGACATCCAGAAGTATAAACTCGAGTTTATACTTCTGGATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172611.2-1983s21c1
Sequence:CCGGCTCGCAGTCTTCGGCAATAATCTCGAGATTATTGCCGAAGACTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1703s21c1
Sequence:CCGGAGAGGAACAAGGTGATCAAACCTCGAGGTTTGATCACCTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172611.1-1782s1c1
Sequence:CCGGGCATGGGAATTGCTGTTTCTACTCGAGTAGAAACAGCAATTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201089    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172611.1-3395s1c1
Sequence:CCGGCCTGGAATATGCTTGTGCTATCTCGAGATAGCACAAGCATATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172611.1-3047s1c1
Sequence:CCGGCCTTCAGATGTCACTGAGATTCTCGAGAATCTCAGTGACATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172611
GRAMD4 MISSION shRNA Lentiviral Transduction Particles
GRAM domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1184s21c1
Sequence:CCGGAGACCACGCAGAAGCTCTATGCTCGAGCATAGAGCTTCTGCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1908s21c1
Sequence:CCGGTGGCGGTGACAGCTAGTATTGCTCGAGCAATACTAGCTGTCACCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1735s21c1
Sequence:CCGGACAGACATCCAGAAGTATAAACTCGAGTTTATACTTCTGGATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172611.2-1983s21c1
Sequence:CCGGCTCGCAGTCTTCGGCAATAATCTCGAGATTATTGCCGAAGACTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172611.2-1703s21c1
Sequence:CCGGAGAGGAACAAGGTGATCAAACCTCGAGGTTTGATCACCTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172611.1-1782s1c1
Sequence:CCGGGCATGGGAATTGCTGTTTCTACTCGAGTAGAAACAGCAATTCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201089    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172611.1-3395s1c1
Sequence:CCGGCCTGGAATATGCTTGTGCTATCTCGAGATAGCACAAGCATATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172611.1-3047s1c1
Sequence:CCGGCCTTCAGATGTCACTGAGATTCTCGAGAATCTCAGTGACATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks