EMAIL THIS PAGE TO A FRIEND

GRAP

GRB2-related adaptor protein

64 Gene Product Result for
UniProtKB ID: Q13588
Gene ID:
Human(10750) Summary: This gene encodes a member of the GRB2/Sem5/Drk family and functions as a cytoplasmic signaling protein which contains an SH2 domain flanked by two SH3 domains. The SH2 domain interacts with ligand-activated receptors for stem cell factor and erythropoietin, and facilitates the formation of a stable complex with the BCR-ABL oncoprotein. This protein also associates with the Ras guanine nucleotide exchange factor SOS1 (son of sevenless homolog 1) through its N-terminal SH3 domain. In general, it couples signals from receptor and cytoplasmic tyrosine kinases to the Ras signaling pathway. [provided by RefSeq, Jul 2012]
Mouse(71520) GRB2-related adaptor protein
Rat(363616) GRB2-related adaptor protein
cow(534491) GRB2-related adaptor protein
domestic cat(101085758) GRB2-related adaptor protein
chicken(416523) GRB2-related adaptor protein
dog(489534) GRB2-related adaptor protein
sheep(101110605) GRB2-related adaptor protein
domestic guinea pig(100727005) GRB2-related adaptor protein
naked mole-rat(101721246) GRB2-related adaptor protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006613 Rosetta Predictions human pricing
NM_001025749 Rosetta Predictions rat pricing
XM_001077873 Rosetta Predictions rat pricing
NM_027817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188001 predicted 859
2 SASI_Hs01_00188002 predicted 393
3 SASI_Hs01_00188003 predicted 1226
4 SASI_Hs01_00188005 predicted 1250
5 SASI_Hs02_00341950 predicted 958
6 SASI_Hs01_00188007 predicted 525
7 SASI_Hs02_00341951 predicted 702
8 SASI_Hs02_00341952 predicted 1077
9 SASI_Hs01_00188010 predicted 1069
10 SASI_Hs02_00341953 predicted 509
11 SASI_Hs01_00188004 predicted 331
12 SASI_Hs01_00188006 predicted 278
13 SASI_Hs01_00188008 predicted 302
14 SASI_Hs01_00188009 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036973 predicted 742
2 SASI_Rn01_00036974 predicted 1009
3 SASI_Rn01_00036975 predicted 686
4 SASI_Rn01_00036976 predicted 1011
5 SASI_Rn01_00036977 predicted 345
6 SASI_Rn01_00036979 predicted 1091
7 SASI_Rn01_00036980 predicted 754
8 SASI_Rn02_00203409 predicted 912
9 SASI_Rn01_00036981 predicted 221
10 SASI_Rn01_00036982 predicted 202
11 SASI_Rn01_00036978 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358845 predicted 444
2 SASI_Rn02_00358846 predicted 452
3 SASI_Rn02_00358847 predicted 407
4 SASI_Rn02_00358848 predicted 444
5 SASI_Rn02_00358849 predicted 425
6 SASI_Rn02_00358850 predicted 422
7 SASI_Rn02_00358851 predicted 222
8 SASI_Rn02_00358852 predicted 298
9 SASI_Rn02_00358853 predicted 396
10 SASI_Rn02_00358854 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180285 predicted 719
2 SASI_Mm01_00180286 predicted 452
3 SASI_Mm01_00180287 predicted 1083
4 SASI_Mm01_00180288 predicted 730
5 SASI_Mm01_00180290 predicted 664
6 SASI_Mm02_00332773 predicted 705
7 SASI_Mm01_00180291 predicted 650
8 SASI_Mm02_00332774 predicted 839
9 SASI_Mm01_00180292 predicted 1052
10 SASI_Mm01_00180293 predicted 396
11 SASI_Mm01_00180289 predicted 850
12 SASI_Mm01_00180294 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006613
GRAP MISSION shRNA Bacterial Glycerol Stock
GRB2-related adaptor protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006613.3-1472s1c1
Sequence:CCGGGCCCTGGCTCTTGTTTGTTTACTCGAGTAAACAAACAAGAGCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-388s1c1
Sequence:CCGGGTCTGTGAACTATGGAGACCACTCGAGTGGTCTCCATAGTTCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-163s1c1
Sequence:CCGGAGACACACTCAAGATCCTGAACTCGAGTTCAGGATCTTGAGTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-514s1c1
Sequence:CCGGCATCGCCAAGAAGCGGCAGATCTCGAGATCTGCCGCTTCTTGGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-244s1c1
Sequence:CCGGCAAGAACTACATCCGCGTCAACTCGAGTTGACGCGGATGTAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-1087s21c1
Sequence:CCGGTTTCACCCACTGGAGGCTCAACTCGAGTTGAGCCTCCAGTGGGTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-1192s21c1
Sequence:CCGGTGGAGTTGTTCAGGCTGTTGGCTCGAGCCAACAGCCTGAACAACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-866s21c1
Sequence:CCGGACTGAACGTGGGCTCCTAACTCTCGAGAGTTAGGAGCCCACGTTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006613
GRAP MISSION shRNA shRNA Plasmid DNA
GRB2-related adaptor protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006613.3-1472s1c1
Sequence:CCGGGCCCTGGCTCTTGTTTGTTTACTCGAGTAAACAAACAAGAGCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-388s1c1
Sequence:CCGGGTCTGTGAACTATGGAGACCACTCGAGTGGTCTCCATAGTTCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-163s1c1
Sequence:CCGGAGACACACTCAAGATCCTGAACTCGAGTTCAGGATCTTGAGTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-514s1c1
Sequence:CCGGCATCGCCAAGAAGCGGCAGATCTCGAGATCTGCCGCTTCTTGGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-244s1c1
Sequence:CCGGCAAGAACTACATCCGCGTCAACTCGAGTTGACGCGGATGTAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-1087s21c1
Sequence:CCGGTTTCACCCACTGGAGGCTCAACTCGAGTTGAGCCTCCAGTGGGTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-1192s21c1
Sequence:CCGGTGGAGTTGTTCAGGCTGTTGGCTCGAGCCAACAGCCTGAACAACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-866s21c1
Sequence:CCGGACTGAACGTGGGCTCCTAACTCTCGAGAGTTAGGAGCCCACGTTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006613
GRAP MISSION shRNA Lentiviral Transduction Particles
GRB2-related adaptor protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006613.3-1472s1c1
Sequence:CCGGGCCCTGGCTCTTGTTTGTTTACTCGAGTAAACAAACAAGAGCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-388s1c1
Sequence:CCGGGTCTGTGAACTATGGAGACCACTCGAGTGGTCTCCATAGTTCACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-163s1c1
Sequence:CCGGAGACACACTCAAGATCCTGAACTCGAGTTCAGGATCTTGAGTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-514s1c1
Sequence:CCGGCATCGCCAAGAAGCGGCAGATCTCGAGATCTGCCGCTTCTTGGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006613.3-244s1c1
Sequence:CCGGCAAGAACTACATCCGCGTCAACTCGAGTTGACGCGGATGTAGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-1087s21c1
Sequence:CCGGTTTCACCCACTGGAGGCTCAACTCGAGTTGAGCCTCCAGTGGGTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-1192s21c1
Sequence:CCGGTGGAGTTGTTCAGGCTGTTGGCTCGAGCCAACAGCCTGAACAACTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006613.3-866s21c1
Sequence:CCGGACTGAACGTGGGCTCCTAACTCTCGAGAGTTAGGAGCCCACGTTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027817
GRAP MISSION shRNA Bacterial Glycerol Stock
GRB2-related adaptor protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027817.1-980s1c1
Sequence:CCGGCGTCCATAAGAGTGCAAAGTTCTCGAGAACTTTGCACTCTTATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-96s1c1
Sequence:CCGGCACGCTTAAGATCCTGAACATCTCGAGATGTTCAGGATCTTAAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-172s1c1
Sequence:CCGGCCCAAGAACTACATCCGTGTACTCGAGTACACGGATGTAGTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-121s1c1
Sequence:CCGGGATGACCAGAACTGGTACAAACTCGAGTTTGTACCAGTTCTGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-309s1c1
Sequence:CCGGGTTCTCCGTCTCTGTGAATTACTCGAGTAATTCACAGAGACGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027817
GRAP MISSION shRNA shRNA Plasmid DNA
GRB2-related adaptor protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027817.1-980s1c1
Sequence:CCGGCGTCCATAAGAGTGCAAAGTTCTCGAGAACTTTGCACTCTTATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-96s1c1
Sequence:CCGGCACGCTTAAGATCCTGAACATCTCGAGATGTTCAGGATCTTAAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-172s1c1
Sequence:CCGGCCCAAGAACTACATCCGTGTACTCGAGTACACGGATGTAGTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-121s1c1
Sequence:CCGGGATGACCAGAACTGGTACAAACTCGAGTTTGTACCAGTTCTGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-309s1c1
Sequence:CCGGGTTCTCCGTCTCTGTGAATTACTCGAGTAATTCACAGAGACGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027817
GRAP MISSION shRNA Lentiviral Transduction Particles
GRB2-related adaptor protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027817.1-980s1c1
Sequence:CCGGCGTCCATAAGAGTGCAAAGTTCTCGAGAACTTTGCACTCTTATGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-96s1c1
Sequence:CCGGCACGCTTAAGATCCTGAACATCTCGAGATGTTCAGGATCTTAAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-172s1c1
Sequence:CCGGCCCAAGAACTACATCCGTGTACTCGAGTACACGGATGTAGTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-121s1c1
Sequence:CCGGGATGACCAGAACTGGTACAAACTCGAGTTTGTACCAGTTCTGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027817.1-309s1c1
Sequence:CCGGGTTCTCCGTCTCTGTGAATTACTCGAGTAATTCACAGAGACGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)