EMAIL THIS PAGE TO A FRIEND

GRAPL

GRB2-related adaptor protein-like

34 Gene Product Result for
Species: Human GRAPL(400581)
UniProtKB ID: Q8TC17, B2RXI8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129778 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720657 Rosetta Predictions human pricing
XM_001723190 Rosetta Predictions human pricing
XM_928199 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00438047 predicted 260
2 SASI_Hs02_00438048 predicted 249
3 SASI_Hs02_00438049 predicted 199
4 SASI_Hs02_00438050 predicted 226
5 SASI_Hs02_00438051 predicted 236
6 SASI_Hs02_00438052 predicted 203
7 SASI_Hs02_00438053 predicted 203
8 SASI_Hs02_00438054 predicted 191
9 SASI_Hs02_00438055 predicted 285
10 SASI_Hs02_00438056 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00453825 predicted 255
2 SASI_Hs02_00453826 predicted 418
3 SASI_Hs02_00453827 predicted 363
4 SASI_Hs02_00453828 predicted 394
5 SASI_Hs02_00453829 predicted 243
6 SASI_Hs02_00453830 predicted 208
7 SASI_Hs02_00453831 predicted 201
8 SASI_Hs02_00453832 predicted 285
9 SASI_Hs02_00453833 predicted 412
10 SASI_Hs02_00453834 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287256 predicted 258
2 SASI_Hs01_00287257 predicted 257
3 SASI_Hs01_00287258 predicted 256
4 SASI_Hs01_00287259 predicted 230
5 SASI_Hs01_00287260 predicted 243
6 SASI_Hs01_00287261 predicted 208
7 SASI_Hs01_00287262 predicted 202
8 SASI_Hs01_00287263 predicted 213
9 SASI_Hs01_00287264 predicted 252
10 SASI_Hs01_00287265 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129778
GRAPL MISSION shRNA Bacterial Glycerol Stock
GRB2-related adaptor protein-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-774s21c1
Sequence:CCGGCTTCCGTCAAGCACCCATTTACTCGAGTAAATGGGTGCTTGACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-572s21c1
Sequence:CCGGTGCATCCAAGTCGCATCCGTACTCGAGTACGGATGCGACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129778.1-433s21c1
Sequence:CCGGGTTCTCTGTGTCTGTGAATAACTCGAGTTATTCACAGACACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-633s21c1
Sequence:CCGGGCTGCTGCAGAGACCAAGTTTCTCGAGAAACTTGGTCTCTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-732s21c1
Sequence:CCGGCCTCACCAAGCACTTCCATTTCTCGAGAAATGGAAGTGCTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129778
GRAPL MISSION shRNA shRNA Plasmid DNA
GRB2-related adaptor protein-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-774s21c1
Sequence:CCGGCTTCCGTCAAGCACCCATTTACTCGAGTAAATGGGTGCTTGACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-572s21c1
Sequence:CCGGTGCATCCAAGTCGCATCCGTACTCGAGTACGGATGCGACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129778.1-433s21c1
Sequence:CCGGGTTCTCTGTGTCTGTGAATAACTCGAGTTATTCACAGACACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-633s21c1
Sequence:CCGGGCTGCTGCAGAGACCAAGTTTCTCGAGAAACTTGGTCTCTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-732s21c1
Sequence:CCGGCCTCACCAAGCACTTCCATTTCTCGAGAAATGGAAGTGCTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129778
GRAPL MISSION shRNA Lentiviral Transduction Particles
GRB2-related adaptor protein-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-774s21c1
Sequence:CCGGCTTCCGTCAAGCACCCATTTACTCGAGTAAATGGGTGCTTGACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-572s21c1
Sequence:CCGGTGCATCCAAGTCGCATCCGTACTCGAGTACGGATGCGACTTGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129778.1-433s21c1
Sequence:CCGGGTTCTCTGTGTCTGTGAATAACTCGAGTTATTCACAGACACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-633s21c1
Sequence:CCGGGCTGCTGCAGAGACCAAGTTTCTCGAGAAACTTGGTCTCTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129778.1-732s21c1
Sequence:CCGGCCTCACCAAGCACTTCCATTTCTCGAGAAATGGAAGTGCTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks