EMAIL THIS PAGE TO A FRIEND

GRASP

GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein

58 Gene Product Result for
Synonyms: TAMALIN
UniProtKB ID: Q7Z6J2, Q6PIF8, Q7Z741
Gene ID:
Human(160622) Summary: This gene encodes a protein that functions as a molecular scaffold, linking receptors, including group 1 metabotropic glutamate receptors, to neuronal proteins. The encoded protein contains conserved domains, including a leucine zipper sequence, PDZ domain and a C-terminal PDZ-binding motif. Alternately spliced transcript variants have been observed for this gene.[provided by RefSeq, Dec 2012]
Mouse(56149) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Rat(192254) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Zebrafish(558950) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
dog(608273) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
cow(507181) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
domestic cat(101095752) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
sheep(101113577) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
domestic guinea pig(100733159) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
naked mole-rat(101708861) GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181711 Rosetta Predictions human pricing
NM_138894 Rosetta Predictions rat pricing
NM_019518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370316 predicted 617
2 SASI_Hs01_00192468 predicted 430
3 SASI_Hs02_00370317 predicted 355
4 SASI_Hs01_00192470 predicted 525
5 SASI_Hs01_00192471 predicted 392
6 SASI_Hs01_00192472 predicted 344
7 SASI_Hs01_00192473 predicted 398
8 SASI_Hs01_00192474 predicted 531
9 SASI_Hs02_00370318 predicted 392
10 SASI_Hs01_00192475 predicted 378
11 SASI_Hs01_00192469 predicted 1384
12 SASI_Hs01_00192476 predicted 514
13 SASI_Hs01_00192477 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062766 predicted 609
2 SASI_Rn01_00062767 predicted 576
3 SASI_Rn02_00268342 predicted 394
4 SASI_Rn01_00062768 predicted 591
5 SASI_Rn01_00062769 predicted 305
6 SASI_Rn01_00062771 predicted 568
7 SASI_Rn02_00268343 predicted 527
8 SASI_Rn01_00062772 predicted 351
9 SASI_Rn01_00062773 predicted 290
10 SASI_Rn01_00062774 predicted 689
11 SASI_Rn01_00062765 predicted 568
12 SASI_Rn01_00062770 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134881 predicted 563
2 SASI_Mm01_00134882 predicted 421
3 SASI_Mm01_00134883 predicted 385
4 SASI_Mm01_00134884 predicted 658
5 SASI_Mm01_00134885 predicted 782
6 SASI_Mm01_00134886 predicted 823
7 SASI_Mm01_00134887 predicted 594
8 SASI_Mm01_00134888 predicted 741
9 SASI_Mm01_00134889 predicted 354
10 SASI_Mm02_00324562 predicted 428
11 SASI_Mm01_00134880 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181711
GRASP MISSION shRNA Bacterial Glycerol Stock
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-525s21c1
Sequence:CCGGAGCGTCAATGGCCTGAATGTGCTCGAGCACATTCAGGCCATTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-580s21c1
Sequence:CCGGTTAAGGCGTCAGGCAATGTTCCTCGAGGAACATTGCCTGACGCCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-602s21c1
Sequence:CCGGCAGACTGGAAACTCTATATGGCTCGAGCCATATAGAGTTTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-557s1c1
Sequence:CCGGGCATCGAGAGATTGTGGACATCTCGAGATGTCCACAATCTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-905s1c1
Sequence:CCGGCGTCTACCACACGTGCTTCTTCTCGAGAAGAAGCACGTGTGGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-624s1c1
Sequence:CCGGACATCAATTCGGAAGGCAGAACTCGAGTTCTGCCTTCCGAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-378s1c1
Sequence:CCGGGATAACCAGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCTGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-438s1c1
Sequence:CCGGCGTGTGGAAATGGTGACCTTTCTCGAGAAAGGTCACCATTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181711
GRASP MISSION shRNA shRNA Plasmid DNA
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-525s21c1
Sequence:CCGGAGCGTCAATGGCCTGAATGTGCTCGAGCACATTCAGGCCATTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-580s21c1
Sequence:CCGGTTAAGGCGTCAGGCAATGTTCCTCGAGGAACATTGCCTGACGCCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-602s21c1
Sequence:CCGGCAGACTGGAAACTCTATATGGCTCGAGCCATATAGAGTTTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-557s1c1
Sequence:CCGGGCATCGAGAGATTGTGGACATCTCGAGATGTCCACAATCTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-905s1c1
Sequence:CCGGCGTCTACCACACGTGCTTCTTCTCGAGAAGAAGCACGTGTGGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-624s1c1
Sequence:CCGGACATCAATTCGGAAGGCAGAACTCGAGTTCTGCCTTCCGAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-378s1c1
Sequence:CCGGGATAACCAGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCTGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-438s1c1
Sequence:CCGGCGTGTGGAAATGGTGACCTTTCTCGAGAAAGGTCACCATTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181711
GRASP MISSION shRNA Lentiviral Transduction Particles
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-525s21c1
Sequence:CCGGAGCGTCAATGGCCTGAATGTGCTCGAGCACATTCAGGCCATTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-580s21c1
Sequence:CCGGTTAAGGCGTCAGGCAATGTTCCTCGAGGAACATTGCCTGACGCCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181711.2-602s21c1
Sequence:CCGGCAGACTGGAAACTCTATATGGCTCGAGCCATATAGAGTTTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-557s1c1
Sequence:CCGGGCATCGAGAGATTGTGGACATCTCGAGATGTCCACAATCTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-905s1c1
Sequence:CCGGCGTCTACCACACGTGCTTCTTCTCGAGAAGAAGCACGTGTGGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-624s1c1
Sequence:CCGGACATCAATTCGGAAGGCAGAACTCGAGTTCTGCCTTCCGAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-378s1c1
Sequence:CCGGGATAACCAGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCTGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181711.1-438s1c1
Sequence:CCGGCGTGTGGAAATGGTGACCTTTCTCGAGAAAGGTCACCATTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019518
VALIDATED
GRASP MISSION shRNA Bacterial Glycerol Stock
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-784s21c1
Sequence:CCGGTGAAAGACCCAAGCATCTATGCTCGAGCATAGATGCTTGGGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019518.3-1283s21c1
Sequence:CCGGGTGGGCAGGTGGGAAGTATTTCTCGAGAAATACTTCCCACCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-391s21c1
Sequence:CCGGAGGTTCTAACTTTGGAGAAAGCTCGAGCTTTCTCCAAAGTTAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-728s21c1
Sequence:CCGGGGGAGAATACAGGTCACTTATCTCGAGATAAGTGACCTGTATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-943s21c1
Sequence:CCGGTGTACCACACGTGCTTCTTTGCTCGAGCAAAGAAGCACGTGTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-1285s1c1
Sequence:CCGGGCAGGTGGGAAGTATTTATTTCTCGAGAAATAAATACTTCCCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019518.2-689s1c1
Sequence:CCGGGCCTGCAGTACCTTAAGCAAACTCGAGTTTGCTTAAGGTACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-339s1c1
Sequence:CCGGCTCAGGATTCCGTTGGAAGAACTCGAGTTCTTCCAACGGAATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019518.2-381s1c1
Sequence:CCGGGCAACGGAAGGTTCTAACTTTCTCGAGAAAGTTAGAACCTTCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-594s1c1
Sequence:CCGGCCGGGAGATTGTCGATATCATCTCGAGATGATATCGACAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019518
VALIDATED
GRASP MISSION shRNA shRNA Plasmid DNA
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-784s21c1
Sequence:CCGGTGAAAGACCCAAGCATCTATGCTCGAGCATAGATGCTTGGGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019518.3-1283s21c1
Sequence:CCGGGTGGGCAGGTGGGAAGTATTTCTCGAGAAATACTTCCCACCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-391s21c1
Sequence:CCGGAGGTTCTAACTTTGGAGAAAGCTCGAGCTTTCTCCAAAGTTAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-728s21c1
Sequence:CCGGGGGAGAATACAGGTCACTTATCTCGAGATAAGTGACCTGTATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-943s21c1
Sequence:CCGGTGTACCACACGTGCTTCTTTGCTCGAGCAAAGAAGCACGTGTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-1285s1c1
Sequence:CCGGGCAGGTGGGAAGTATTTATTTCTCGAGAAATAAATACTTCCCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019518.2-689s1c1
Sequence:CCGGGCCTGCAGTACCTTAAGCAAACTCGAGTTTGCTTAAGGTACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-339s1c1
Sequence:CCGGCTCAGGATTCCGTTGGAAGAACTCGAGTTCTTCCAACGGAATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019518.2-381s1c1
Sequence:CCGGGCAACGGAAGGTTCTAACTTTCTCGAGAAAGTTAGAACCTTCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-594s1c1
Sequence:CCGGCCGGGAGATTGTCGATATCATCTCGAGATGATATCGACAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019518
VALIDATED
GRASP MISSION shRNA Lentiviral Transduction Particles
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-784s21c1
Sequence:CCGGTGAAAGACCCAAGCATCTATGCTCGAGCATAGATGCTTGGGTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019518.3-1283s21c1
Sequence:CCGGGTGGGCAGGTGGGAAGTATTTCTCGAGAAATACTTCCCACCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-391s21c1
Sequence:CCGGAGGTTCTAACTTTGGAGAAAGCTCGAGCTTTCTCCAAAGTTAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-728s21c1
Sequence:CCGGGGGAGAATACAGGTCACTTATCTCGAGATAAGTGACCTGTATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019518.3-943s21c1
Sequence:CCGGTGTACCACACGTGCTTCTTTGCTCGAGCAAAGAAGCACGTGTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-1285s1c1
Sequence:CCGGGCAGGTGGGAAGTATTTATTTCTCGAGAAATAAATACTTCCCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019518.2-689s1c1
Sequence:CCGGGCCTGCAGTACCTTAAGCAAACTCGAGTTTGCTTAAGGTACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-339s1c1
Sequence:CCGGCTCAGGATTCCGTTGGAAGAACTCGAGTTCTTCCAACGGAATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019518.2-381s1c1
Sequence:CCGGGCAACGGAAGGTTCTAACTTTCTCGAGAAAGTTAGAACCTTCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019518.2-594s1c1
Sequence:CCGGCCGGGAGATTGTCGATATCATCTCGAGATGATATCGACAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks