EMAIL THIS PAGE TO A FRIEND

GRB10

growth factor receptor-bound protein 10

169 Gene Product Result for
Synonyms: GRB-IR Grb-10 IRBP MEG1 RSS
Gene ID:
Human(2887) Summary: The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
Mouse(14783) growth factor receptor bound protein 10
Rat(498416) growth factor receptor bound protein 10
chicken(420948) growth factor receptor-bound protein 10
domestic cat(101083918) growth factor receptor-bound protein 10
cow(407210) growth factor receptor-bound protein 10
Horse(100052610) growth factor receptor-bound protein 10
dog(607755) growth factor receptor-bound protein 10
domestic guinea pig(100733471) growth factor receptor-bound protein 10
naked mole-rat(101725734) growth factor receptor-bound protein 10
sheep(101111275) growth factor receptor-bound protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001549 Rosetta Predictions human pricing
NM_001001550 Rosetta Predictions human pricing
NM_001001555 Rosetta Predictions human pricing
NM_005311 Rosetta Predictions human pricing
NM_001109093 Rosetta Predictions rat pricing
NM_010345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023250 predicted 1901
2 SASI_Hs01_00023251 predicted 1820
3 SASI_Hs01_00023252 predicted 1451
4 SASI_Hs01_00023253 predicted 1092
5 SASI_Hs01_00023254 predicted 1675
6 SASI_Hs01_00023255 predicted 1325
7 SASI_Hs01_00023256 predicted 560
8 SASI_Hs01_00023257 predicted 1811
9 SASI_Hs01_00023258 predicted 1815
10 SASI_Hs01_00023259 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117698 predicted 2118
2 SASI_Hs01_00117699 predicted 2037
3 SASI_Hs01_00117700 predicted 1672
4 SASI_Hs01_00117701 predicted 1316
5 SASI_Hs01_00117702 predicted 1897
6 SASI_Hs01_00117703 predicted 1549
7 SASI_Hs01_00117704 predicted 640
8 SASI_Hs01_00117705 predicted 2034
9 SASI_Hs01_00117706 predicted 2041
10 SASI_Hs01_00117707 predicted 2130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218069 predicted 2369
2 SASI_Hs01_00218070 predicted 2288
3 SASI_Hs01_00218071 predicted 1922
4 SASI_Hs01_00218072 predicted 1555
5 SASI_Hs01_00218073 predicted 2136
6 SASI_Hs01_00218074 predicted 1787
7 SASI_Hs01_00218075 predicted 890
8 SASI_Hs01_00218076 predicted 2283
9 SASI_Hs01_00218077 predicted 2278
10 SASI_Hs01_00218078 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057617 predicted 2046
2 SASI_Hs01_00057618 predicted 1960
3 SASI_Hs01_00057619 predicted 1588
4 SASI_Hs01_00057620 predicted 1233
5 SASI_Hs01_00057621 predicted 1810
6 SASI_Hs01_00057622 predicted 1461
7 SASI_Hs01_00057623 predicted 560
8 SASI_Hs01_00057624 predicted 1953
9 SASI_Hs01_00057625 predicted 1961
10 SASI_Hs01_00057626 predicted 2050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245060 predicted 1570
2 SASI_Rn02_00245061 predicted 2034
3 SASI_Rn02_00245062 predicted 973
4 SASI_Rn02_00245063 predicted 966
5 SASI_Rn02_00245064 predicted 2138
6 SASI_Rn02_00245065 predicted 778
7 SASI_Rn02_00245066 predicted 974
8 SASI_Rn02_00245067 predicted 805
9 SASI_Rn02_00245068 predicted 1321
10 SASI_Rn02_00245069 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036321 predicted 1331
2 SASI_Mm01_00036322 predicted 1894
3 SASI_Mm01_00036323 predicted 299
4 SASI_Mm01_00036324 predicted 990
5 SASI_Mm02_00318361 predicted 785
6 SASI_Mm01_00036325 predicted 1585
7 SASI_Mm01_00036326 predicted 621
8 SASI_Mm01_00036327 predicted 818
9 SASI_Mm01_00036328 predicted 516
10 SASI_Mm01_00036329 predicted 2108
11 SASI_Mm01_00036320 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001549
VALIDATED
GRB10 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 10
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-2013s1c1
Sequence:CCGGCCCTGGAATAATCTTGACAATCTCGAGATTGTCAAGATTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001549.1-803s1c1
Sequence:CCGGCCCATGAATTTCTTCCCAGAACTCGAGTTCTGGGAAGAAATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-1459s1c1
Sequence:CCGGCCAGAGTAATCCAAAGGCATTCTCGAGAATGCCTTTGGATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001549.1-524s1c1
Sequence:CCGGGCCGCAAAGCAGGATGTTAAACTCGAGTTTAACATCCTGCTTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-191s1c1
Sequence:CCGGGCCCTGGTGAACGATATGAATCTCGAGATTCATATCGTTCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001549.2-1833s21c1
Sequence:CCGGGTTGGACTTAAACGACGATTTCTCGAGAAATCGTCGTTTAAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-1094s21c1
Sequence:CCGGATGCTCCTTTACCAGAATTACCTCGAGGTAATTCTGGTAAAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-967s21c1
Sequence:CCGGAGACCACGGGCTCTGCATAAACTCGAGTTTATGCAGAGCCCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001549.2-844s21c1
Sequence:CCGGGCAGTCAAATGGCAGTCAAACCTCGAGGTTTGACTGCCATTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-739s21c1
Sequence:CCGGCATGGCCAGTGAGAGTAAATTCTCGAGAATTTACTCTCACTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-1396s21c1
Sequence:CCGGGGAATCCCACAGGATCATTAACTCGAGTTAATGATCCTGTGGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001549.2-1565s21c1
Sequence:CCGGGATGACGGGAACACCAAATTCCTCGAGGAATTTGGTGTTCCCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001549
VALIDATED
GRB10 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 10
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-2013s1c1
Sequence:CCGGCCCTGGAATAATCTTGACAATCTCGAGATTGTCAAGATTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001549.1-803s1c1
Sequence:CCGGCCCATGAATTTCTTCCCAGAACTCGAGTTCTGGGAAGAAATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-1459s1c1
Sequence:CCGGCCAGAGTAATCCAAAGGCATTCTCGAGAATGCCTTTGGATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001549.1-524s1c1
Sequence:CCGGGCCGCAAAGCAGGATGTTAAACTCGAGTTTAACATCCTGCTTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-191s1c1
Sequence:CCGGGCCCTGGTGAACGATATGAATCTCGAGATTCATATCGTTCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001549.2-1833s21c1
Sequence:CCGGGTTGGACTTAAACGACGATTTCTCGAGAAATCGTCGTTTAAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-1094s21c1
Sequence:CCGGATGCTCCTTTACCAGAATTACCTCGAGGTAATTCTGGTAAAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-967s21c1
Sequence:CCGGAGACCACGGGCTCTGCATAAACTCGAGTTTATGCAGAGCCCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001549.2-844s21c1
Sequence:CCGGGCAGTCAAATGGCAGTCAAACCTCGAGGTTTGACTGCCATTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-739s21c1
Sequence:CCGGCATGGCCAGTGAGAGTAAATTCTCGAGAATTTACTCTCACTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-1396s21c1
Sequence:CCGGGGAATCCCACAGGATCATTAACTCGAGTTAATGATCCTGTGGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001549.2-1565s21c1
Sequence:CCGGGATGACGGGAACACCAAATTCCTCGAGGAATTTGGTGTTCCCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001549
VALIDATED
GRB10 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 10
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-2013s1c1
Sequence:CCGGCCCTGGAATAATCTTGACAATCTCGAGATTGTCAAGATTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001549.1-803s1c1
Sequence:CCGGCCCATGAATTTCTTCCCAGAACTCGAGTTCTGGGAAGAAATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-1459s1c1
Sequence:CCGGCCAGAGTAATCCAAAGGCATTCTCGAGAATGCCTTTGGATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001549.1-524s1c1
Sequence:CCGGGCCGCAAAGCAGGATGTTAAACTCGAGTTTAACATCCTGCTTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001549.1-191s1c1
Sequence:CCGGGCCCTGGTGAACGATATGAATCTCGAGATTCATATCGTTCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001549.2-1833s21c1
Sequence:CCGGGTTGGACTTAAACGACGATTTCTCGAGAAATCGTCGTTTAAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-1094s21c1
Sequence:CCGGATGCTCCTTTACCAGAATTACCTCGAGGTAATTCTGGTAAAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-967s21c1
Sequence:CCGGAGACCACGGGCTCTGCATAAACTCGAGTTTATGCAGAGCCCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001549.2-844s21c1
Sequence:CCGGGCAGTCAAATGGCAGTCAAACCTCGAGGTTTGACTGCCATTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-739s21c1
Sequence:CCGGCATGGCCAGTGAGAGTAAATTCTCGAGAATTTACTCTCACTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001549.2-1396s21c1
Sequence:CCGGGGAATCCCACAGGATCATTAACTCGAGTTAATGATCCTGTGGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001549.2-1565s21c1
Sequence:CCGGGATGACGGGAACACCAAATTCCTCGAGGAATTTGGTGTTCCCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010345
VALIDATED
GRB10 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-2392s1c1
Sequence:CCGGCCCTGGAATAACCTTGACAATCTCGAGATTGTCAAGGTTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010345.2-485s1c1
Sequence:CCGGGCAGTTAAGAACTGCATCTCTCTCGAGAGAGATGCAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010345.2-1672s1c1
Sequence:CCGGGCACACGGATGAATATCCTAACTCGAGTTAGGATATTCATCCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-985s1c1
Sequence:CCGGCCATGCCAAGTGAGAGCAAATCTCGAGATTTGCTCTCACTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-1841s1c1
Sequence:CCGGCCAGAGTAATCCAAAGGCGTTCTCGAGAACGCCTTTGGATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010345
VALIDATED
GRB10 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-2392s1c1
Sequence:CCGGCCCTGGAATAACCTTGACAATCTCGAGATTGTCAAGGTTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010345.2-485s1c1
Sequence:CCGGGCAGTTAAGAACTGCATCTCTCTCGAGAGAGATGCAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010345.2-1672s1c1
Sequence:CCGGGCACACGGATGAATATCCTAACTCGAGTTAGGATATTCATCCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-985s1c1
Sequence:CCGGCCATGCCAAGTGAGAGCAAATCTCGAGATTTGCTCTCACTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-1841s1c1
Sequence:CCGGCCAGAGTAATCCAAAGGCGTTCTCGAGAACGCCTTTGGATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010345
VALIDATED
GRB10 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-2392s1c1
Sequence:CCGGCCCTGGAATAACCTTGACAATCTCGAGATTGTCAAGGTTATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010345.2-485s1c1
Sequence:CCGGGCAGTTAAGAACTGCATCTCTCTCGAGAGAGATGCAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010345.2-1672s1c1
Sequence:CCGGGCACACGGATGAATATCCTAACTCGAGTTAGGATATTCATCCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-985s1c1
Sequence:CCGGCCATGCCAAGTGAGAGCAAATCTCGAGATTTGCTCTCACTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010345.2-1841s1c1
Sequence:CCGGCCAGAGTAATCCAAAGGCGTTCTCGAGAACGCCTTTGGATTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks