EMAIL THIS PAGE TO A FRIEND

GRB14

growth factor receptor-bound protein 14

49 Gene Product Result for
UniProtKB ID: Q14449, Q7Z6I1
Gene ID:
Human(2888) Summary: The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Transcript variants have been reported for this gene, but their full-length natures have not been determined to date. [provided by RefSeq, Jul 2008]
Mouse(50915) growth factor receptor bound protein 14
Rat(58844) growth factor receptor bound protein 14
chicken(424183) growth factor receptor-bound protein 14
domestic cat(101100905) growth factor receptor-bound protein 14
cow(497029) growth factor receptor-bound protein 14
Horse(100061818) growth factor receptor-bound protein 14
dog(478770) growth factor receptor-bound protein 14
Goat(100861137) growth factor receptor-bound protein 14
sheep(101105217) growth factor receptor-bound protein 14
domestic guinea pig(100718629) growth factor receptor-bound protein 14
naked mole-rat(101717007) growth factor receptor-bound protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004490 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030091 MISSION® esiRNA esiRNA human GRB14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004490 Rosetta Predictions human pricing
NM_031623 Rosetta Predictions rat pricing
NM_016719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233281 predicted 792
2 SASI_Hs01_00233282 predicted 1713
3 SASI_Hs01_00233283 predicted 2048
4 SASI_Hs01_00233284 predicted 808
5 SASI_Hs01_00233285 predicted 1005
6 SASI_Hs01_00233286 predicted 883
7 SASI_Hs01_00233287 predicted 1626
8 SASI_Hs01_00233288 predicted 2090
9 SASI_Hs01_00233289 predicted 1047
10 SASI_Hs01_00233290 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119502 predicted 261
2 SASI_Rn01_00119503 predicted 620
3 SASI_Rn01_00119504 predicted 1230
4 SASI_Rn01_00119505 predicted 1489
5 SASI_Rn01_00119506 predicted 618
6 SASI_Rn01_00119507 predicted 481
7 SASI_Rn01_00119508 predicted 371
8 SASI_Rn01_00119509 predicted 598
9 SASI_Rn01_00119510 predicted 321
10 SASI_Rn01_00119511 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025112 predicted 707
2 SASI_Mm01_00025114 predicted 673
3 SASI_Mm01_00025116 predicted 1569
4 SASI_Mm01_00025117 predicted 572
5 SASI_Mm02_00323412 predicted 1421
6 SASI_Mm01_00025119 predicted 656
7 SASI_Mm01_00025120 predicted 380
8 SASI_Mm01_00025121 predicted 667
9 SASI_Mm02_00323413 predicted 1212
10 SASI_Mm02_00323414 predicted 399
11 SASI_Mm01_00025113 predicted 628
12 SASI_Mm01_00025115 predicted 748
13 SASI_Mm01_00025118 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016719
VALIDATED
GRB14 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016719.1-1778s21c1
Sequence:CCGGGGATGCAAAGGAGAATGATTACTCGAGTAATCATTCTCCTTTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-576s21c1
Sequence:CCGGCACCTATCTCACATAGGTTTACTCGAGTAAACCTATGTGAGATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-927s21c1
Sequence:CCGGTCCAAGGAACCACGGCATTTGCTCGAGCAAATGCCGTGGTTCCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-429s21c1
Sequence:CCGGAGGAAGAAGCAGGTGATTAAACTCGAGTTTAATCACCTGCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016719.1-1021s21c1
Sequence:CCGGCTCCCTATGGATTCTGCTTAACTCGAGTTAAGCAGAATCCATAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016719.1-1740s1c1
Sequence:CCGGCCAAACTGTGTGTCACTCGTTCTCGAGAACGAGTGACACACAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-576s1c1
Sequence:CCGGCACCTATCTCACATAGGTTTACTCGAGTAAACCTATGTGAGATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-1021s1c1
Sequence:CCGGCTCCCTATGGATTCTGCTTAACTCGAGTTAAGCAGAATCCATAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016719.1-575s1c1
Sequence:CCGGGCACCTATCTCACATAGGTTTCTCGAGAAACCTATGTGAGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-1022s1c1
Sequence:CCGGTCCCTATGGATTCTGCTTAAACTCGAGTTTAAGCAGAATCCATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016719
VALIDATED
GRB14 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016719.1-1778s21c1
Sequence:CCGGGGATGCAAAGGAGAATGATTACTCGAGTAATCATTCTCCTTTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-576s21c1
Sequence:CCGGCACCTATCTCACATAGGTTTACTCGAGTAAACCTATGTGAGATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-927s21c1
Sequence:CCGGTCCAAGGAACCACGGCATTTGCTCGAGCAAATGCCGTGGTTCCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-429s21c1
Sequence:CCGGAGGAAGAAGCAGGTGATTAAACTCGAGTTTAATCACCTGCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016719.1-1021s21c1
Sequence:CCGGCTCCCTATGGATTCTGCTTAACTCGAGTTAAGCAGAATCCATAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016719.1-1740s1c1
Sequence:CCGGCCAAACTGTGTGTCACTCGTTCTCGAGAACGAGTGACACACAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-576s1c1
Sequence:CCGGCACCTATCTCACATAGGTTTACTCGAGTAAACCTATGTGAGATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-1021s1c1
Sequence:CCGGCTCCCTATGGATTCTGCTTAACTCGAGTTAAGCAGAATCCATAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016719.1-575s1c1
Sequence:CCGGGCACCTATCTCACATAGGTTTCTCGAGAAACCTATGTGAGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-1022s1c1
Sequence:CCGGTCCCTATGGATTCTGCTTAAACTCGAGTTTAAGCAGAATCCATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016719
VALIDATED
GRB14 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016719.1-1778s21c1
Sequence:CCGGGGATGCAAAGGAGAATGATTACTCGAGTAATCATTCTCCTTTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-576s21c1
Sequence:CCGGCACCTATCTCACATAGGTTTACTCGAGTAAACCTATGTGAGATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-927s21c1
Sequence:CCGGTCCAAGGAACCACGGCATTTGCTCGAGCAAATGCCGTGGTTCCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016719.1-429s21c1
Sequence:CCGGAGGAAGAAGCAGGTGATTAAACTCGAGTTTAATCACCTGCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016719.1-1021s21c1
Sequence:CCGGCTCCCTATGGATTCTGCTTAACTCGAGTTAAGCAGAATCCATAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016719.1-1740s1c1
Sequence:CCGGCCAAACTGTGTGTCACTCGTTCTCGAGAACGAGTGACACACAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-576s1c1
Sequence:CCGGCACCTATCTCACATAGGTTTACTCGAGTAAACCTATGTGAGATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-1021s1c1
Sequence:CCGGCTCCCTATGGATTCTGCTTAACTCGAGTTAAGCAGAATCCATAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016719.1-575s1c1
Sequence:CCGGGCACCTATCTCACATAGGTTTCTCGAGAAACCTATGTGAGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016719.1-1022s1c1
Sequence:CCGGTCCCTATGGATTCTGCTTAAACTCGAGTTTAAGCAGAATCCATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004490
VALIDATED
GRB14 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2017s21c1
Sequence:CCGGAGTAGAAGATGACGGTGAAATCTCGAGATTTCACCGTCATCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004490.2-819s21c1
Sequence:CCGGTGTTGTCAGCAGACCTATTTCCTCGAGGAAATAGGTCTGCTGACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-1244s21c1
Sequence:CCGGCCTGAAATTCATGGTTTCTTACTCGAGTAAGAAACCATGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2168s21c1
Sequence:CCGGAGCCAGAAGTGACTTATTAAACTCGAGTTTAATAAGTCACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2102s21c1
Sequence:CCGGCAACTCAATAAGGGCGTTCTTCTCGAGAAGAACGCCCTTATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-2101s1c1
Sequence:CCGGCAACTCAATAAGGGCGTTCTTCTCGAGAAGAACGCCCTTATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-765s1c1
Sequence:CCGGGCCATCTATTCCAAACCCTTTCTCGAGAAAGGGTTTGGAATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-1243s1c1
Sequence:CCGGCCTGAAATTCATGGTTTCTTACTCGAGTAAGAAACCATGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-1546s1c1
Sequence:CCGGGCGATTAGATTGCTTAAGTATCTCGAGATACTTAAGCAATCTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004490.1-1581s1c1
Sequence:CCGGCCAGAATTATATGCATCCATACTCGAGTATGGATGCATATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004490
VALIDATED
GRB14 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2017s21c1
Sequence:CCGGAGTAGAAGATGACGGTGAAATCTCGAGATTTCACCGTCATCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004490.2-819s21c1
Sequence:CCGGTGTTGTCAGCAGACCTATTTCCTCGAGGAAATAGGTCTGCTGACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-1244s21c1
Sequence:CCGGCCTGAAATTCATGGTTTCTTACTCGAGTAAGAAACCATGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2168s21c1
Sequence:CCGGAGCCAGAAGTGACTTATTAAACTCGAGTTTAATAAGTCACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2102s21c1
Sequence:CCGGCAACTCAATAAGGGCGTTCTTCTCGAGAAGAACGCCCTTATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-2101s1c1
Sequence:CCGGCAACTCAATAAGGGCGTTCTTCTCGAGAAGAACGCCCTTATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-765s1c1
Sequence:CCGGGCCATCTATTCCAAACCCTTTCTCGAGAAAGGGTTTGGAATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-1243s1c1
Sequence:CCGGCCTGAAATTCATGGTTTCTTACTCGAGTAAGAAACCATGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-1546s1c1
Sequence:CCGGGCGATTAGATTGCTTAAGTATCTCGAGATACTTAAGCAATCTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004490.1-1581s1c1
Sequence:CCGGCCAGAATTATATGCATCCATACTCGAGTATGGATGCATATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004490
VALIDATED
GRB14 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2017s21c1
Sequence:CCGGAGTAGAAGATGACGGTGAAATCTCGAGATTTCACCGTCATCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004490.2-819s21c1
Sequence:CCGGTGTTGTCAGCAGACCTATTTCCTCGAGGAAATAGGTCTGCTGACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-1244s21c1
Sequence:CCGGCCTGAAATTCATGGTTTCTTACTCGAGTAAGAAACCATGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2168s21c1
Sequence:CCGGAGCCAGAAGTGACTTATTAAACTCGAGTTTAATAAGTCACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004490.2-2102s21c1
Sequence:CCGGCAACTCAATAAGGGCGTTCTTCTCGAGAAGAACGCCCTTATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-2101s1c1
Sequence:CCGGCAACTCAATAAGGGCGTTCTTCTCGAGAAGAACGCCCTTATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-765s1c1
Sequence:CCGGGCCATCTATTCCAAACCCTTTCTCGAGAAAGGGTTTGGAATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-1243s1c1
Sequence:CCGGCCTGAAATTCATGGTTTCTTACTCGAGTAAGAAACCATGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004490.1-1546s1c1
Sequence:CCGGGCGATTAGATTGCTTAAGTATCTCGAGATACTTAAGCAATCTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004490.1-1581s1c1
Sequence:CCGGCCAGAATTATATGCATCCATACTCGAGTATGGATGCATATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks