EMAIL THIS PAGE TO A FRIEND

GRB2

growth factor receptor-bound protein 2

132 Gene Product Result for
Synonyms: ASH EGFRBP-GRB2 Grb3-3 MST084 MSTP084 NCKAP2
UniProtKB ID: P62993, P29354, Q14450, Q63057, Q63059
Gene ID:
Human(2885) Summary: The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14784) growth factor receptor bound protein 2
Rat(81504) growth factor receptor bound protein 2
domestic guinea pig(100715453) growth factor receptor-bound protein 2
naked mole-rat(101717035) growth factor receptor-bound protein 2
sheep(101109893) growth factor receptor-bound protein 2
chicken(386572) growth factor receptor-bound protein 2
cow(535298) growth factor receptor-bound protein 2
domestic cat(101099916) growth factor receptor-bound protein 2
dog(483312) growth factor receptor-bound protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002086 siRNAs that have been validated in the lab human pricing
NM_203506 siRNAs that have been validated in the lab human pricing
NM_030846 Rosetta Predictions rat pricing
NM_008163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002086 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129586 validated 905
2 SASI_Hs01_00129587 predicted 1008
3 SASI_Hs01_00129588 predicted 1014
4 SASI_Hs01_00129589 predicted 504
5 SASI_Hs01_00129590 predicted 783
6 SASI_Hs01_00129591 predicted 499
7 SASI_Hs01_00129592 predicted 1135
8 SASI_Hs01_00129593 predicted 789
9 SASI_Hs01_00129594 predicted 654
10 SASI_Hs01_00129595 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203506 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168659 validated 784
2 SASI_Hs01_00168661 predicted 891
3 SASI_Hs01_00168662 predicted 891
4 SASI_Hs02_00373442 predicted 660
5 SASI_Hs02_00373443 predicted 501
6 SASI_Hs02_00373444 predicted 1015
7 SASI_Hs02_00373445 predicted 658
8 SASI_Hs02_00373446 predicted 1230
9 SASI_Hs02_00373447 predicted 1371
10 SASI_Hs02_00373448 predicted 537
11 SASI_Hs01_00168660 predicted 827
12 SASI_Hs01_00168663 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264076 predicted 612
2 SASI_Rn02_00264077 predicted 576
3 SASI_Rn02_00264078 predicted 818
4 SASI_Rn02_00264079 predicted 1032
5 SASI_Rn01_00032891 predicted 346
6 SASI_Rn02_00264080 predicted 273
7 SASI_Rn01_00032892 predicted 1052
8 SASI_Rn02_00264081 predicted 389
9 SASI_Rn01_00032893 predicted 743
10 SASI_Rn02_00264082 predicted 292
11 SASI_Rn01_00032894 predicted 727
12 SASI_Rn01_00032895 predicted 213
13 SASI_Rn01_00032896 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068494 predicted 633
2 SASI_Mm02_00313274 predicted 1101
3 SASI_Mm01_00068495 predicted 717
4 SASI_Mm01_00068496 predicted 964
5 SASI_Mm01_00068497 predicted 1167
6 SASI_Mm01_00068498 predicted 1322
7 SASI_Mm01_00068499 predicted 493
8 SASI_Mm01_00068500 predicted 802
9 SASI_Mm01_00068501 predicted 435
10 SASI_Mm01_00068502 predicted 884
11 SASI_Mm01_00068503 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008163
VALIDATED
GRB2 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-1270s1c1
Sequence:CCGGGCATGATGTTTAAGGCCACATCTCGAGATGTGGCCTTAAACATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008163.2-763s1c1
Sequence:CCGGGCAGATATTCTTACGGGACATCTCGAGATGTCCCGTAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-723s1c1
Sequence:CCGGTGGTAGATTACCACAGATCAACTCGAGTTGATCTGTGGTAATCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-881s1c1
Sequence:CCGGCATGTCATGGATAACTCAGATCTCGAGATCTGAGTTATCCATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008163.2-431s1c1
Sequence:CCGGCAGAACTGGTATAAGGCAGAACTCGAGTTCTGCCTTATACCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-723s21c1
Sequence:CCGGTGGTAGATTACCACAGATCAACTCGAGTTGATCTGTGGTAATCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-763s21c1
Sequence:CCGGGCAGATATTCTTACGGGACATCTCGAGATGTCCCGTAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008163.3-1270s21c1
Sequence:CCGGGCATGATGTTTAAGGCCACATCTCGAGATGTGGCCTTAAACATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-431s21c1
Sequence:CCGGCAGAACTGGTATAAGGCAGAACTCGAGTTCTGCCTTATACCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-881s21c1
Sequence:CCGGCATGTCATGGATAACTCAGATCTCGAGATCTGAGTTATCCATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008163
VALIDATED
GRB2 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-1270s1c1
Sequence:CCGGGCATGATGTTTAAGGCCACATCTCGAGATGTGGCCTTAAACATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008163.2-763s1c1
Sequence:CCGGGCAGATATTCTTACGGGACATCTCGAGATGTCCCGTAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-723s1c1
Sequence:CCGGTGGTAGATTACCACAGATCAACTCGAGTTGATCTGTGGTAATCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-881s1c1
Sequence:CCGGCATGTCATGGATAACTCAGATCTCGAGATCTGAGTTATCCATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008163.2-431s1c1
Sequence:CCGGCAGAACTGGTATAAGGCAGAACTCGAGTTCTGCCTTATACCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-723s21c1
Sequence:CCGGTGGTAGATTACCACAGATCAACTCGAGTTGATCTGTGGTAATCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-763s21c1
Sequence:CCGGGCAGATATTCTTACGGGACATCTCGAGATGTCCCGTAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008163.3-1270s21c1
Sequence:CCGGGCATGATGTTTAAGGCCACATCTCGAGATGTGGCCTTAAACATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-431s21c1
Sequence:CCGGCAGAACTGGTATAAGGCAGAACTCGAGTTCTGCCTTATACCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-881s21c1
Sequence:CCGGCATGTCATGGATAACTCAGATCTCGAGATCTGAGTTATCCATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008163
VALIDATED
GRB2 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-1270s1c1
Sequence:CCGGGCATGATGTTTAAGGCCACATCTCGAGATGTGGCCTTAAACATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008163.2-763s1c1
Sequence:CCGGGCAGATATTCTTACGGGACATCTCGAGATGTCCCGTAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-723s1c1
Sequence:CCGGTGGTAGATTACCACAGATCAACTCGAGTTGATCTGTGGTAATCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008163.2-881s1c1
Sequence:CCGGCATGTCATGGATAACTCAGATCTCGAGATCTGAGTTATCCATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008163.2-431s1c1
Sequence:CCGGCAGAACTGGTATAAGGCAGAACTCGAGTTCTGCCTTATACCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-723s21c1
Sequence:CCGGTGGTAGATTACCACAGATCAACTCGAGTTGATCTGTGGTAATCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-763s21c1
Sequence:CCGGGCAGATATTCTTACGGGACATCTCGAGATGTCCCGTAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008163.3-1270s21c1
Sequence:CCGGGCATGATGTTTAAGGCCACATCTCGAGATGTGGCCTTAAACATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-431s21c1
Sequence:CCGGCAGAACTGGTATAAGGCAGAACTCGAGTTCTGCCTTATACCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008163.3-881s21c1
Sequence:CCGGCATGTCATGGATAACTCAGATCTCGAGATCTGAGTTATCCATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002086
VALIDATED
GRB2 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-764s1c1
Sequence:CCGGGATCTACATCTGTCTCCAGAACTCGAGTTCTGGAGACAGATGTAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-790s1c1
Sequence:CCGGCAGATATTCCTGCGGGACATACTCGAGTATGTCCCGCAGGAATATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-492s1c1
Sequence:CCGGCGGCTTCATTCCCAAGAACTACTCGAGTAGTTCTTGGGAATGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-645s1c1
Sequence:CCGGCCTCTCTGTCAAGTTTGGAAACTCGAGTTTCCAAACTTGACAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-565s1c1
Sequence:CCGGGCAGAAGAAATGCTTAGCAAACTCGAGTTTGCTAAGCATTTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-565s21c1
Sequence:CCGGGCAGAAGAAATGCTTAGCAAACTCGAGTTTGCTAAGCATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-764s21c1
Sequence:CCGGGATCTACATCTGTCTCCAGAACTCGAGTTCTGGAGACAGATGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-492s21c1
Sequence:CCGGCGGCTTCATTCCCAAGAACTACTCGAGTAGTTCTTGGGAATGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-790s21c1
Sequence:CCGGCAGATATTCCTGCGGGACATACTCGAGTATGTCCCGCAGGAATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002086
VALIDATED
GRB2 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-764s1c1
Sequence:CCGGGATCTACATCTGTCTCCAGAACTCGAGTTCTGGAGACAGATGTAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-790s1c1
Sequence:CCGGCAGATATTCCTGCGGGACATACTCGAGTATGTCCCGCAGGAATATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-492s1c1
Sequence:CCGGCGGCTTCATTCCCAAGAACTACTCGAGTAGTTCTTGGGAATGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-645s1c1
Sequence:CCGGCCTCTCTGTCAAGTTTGGAAACTCGAGTTTCCAAACTTGACAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-565s1c1
Sequence:CCGGGCAGAAGAAATGCTTAGCAAACTCGAGTTTGCTAAGCATTTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-565s21c1
Sequence:CCGGGCAGAAGAAATGCTTAGCAAACTCGAGTTTGCTAAGCATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-764s21c1
Sequence:CCGGGATCTACATCTGTCTCCAGAACTCGAGTTCTGGAGACAGATGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-492s21c1
Sequence:CCGGCGGCTTCATTCCCAAGAACTACTCGAGTAGTTCTTGGGAATGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-790s21c1
Sequence:CCGGCAGATATTCCTGCGGGACATACTCGAGTATGTCCCGCAGGAATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002086
VALIDATED
GRB2 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-764s1c1
Sequence:CCGGGATCTACATCTGTCTCCAGAACTCGAGTTCTGGAGACAGATGTAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-790s1c1
Sequence:CCGGCAGATATTCCTGCGGGACATACTCGAGTATGTCCCGCAGGAATATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-492s1c1
Sequence:CCGGCGGCTTCATTCCCAAGAACTACTCGAGTAGTTCTTGGGAATGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-645s1c1
Sequence:CCGGCCTCTCTGTCAAGTTTGGAAACTCGAGTTTCCAAACTTGACAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002086.3-565s1c1
Sequence:CCGGGCAGAAGAAATGCTTAGCAAACTCGAGTTTGCTAAGCATTTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-565s21c1
Sequence:CCGGGCAGAAGAAATGCTTAGCAAACTCGAGTTTGCTAAGCATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-764s21c1
Sequence:CCGGGATCTACATCTGTCTCCAGAACTCGAGTTCTGGAGACAGATGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-492s21c1
Sequence:CCGGCGGCTTCATTCCCAAGAACTACTCGAGTAGTTCTTGGGAATGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002086.4-790s21c1
Sequence:CCGGCAGATATTCCTGCGGGACATACTCGAGTATGTCCCGCAGGAATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks