EMAIL THIS PAGE TO A FRIEND

GRB7

growth factor receptor-bound protein 7

102 Gene Product Result for
Gene ID:
Human(2886) Summary: The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with epidermal growth factor receptor (EGFR) and ephrin receptors. The protein plays a role in the integrin signaling pathway and cell migration by binding with focal adhesion kinase (FAK). Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(14786) growth factor receptor bound protein 7
Rat(84427) growth factor receptor bound protein 7
chicken(426597) growth factor receptor-bound protein 7
domestic cat(101092408) growth factor receptor-bound protein 7
cow(508847) growth factor receptor-bound protein 7
Horse(100068063) growth factor receptor-bound protein 7
dog(491021) growth factor receptor-bound protein 7
sheep(101104589) growth factor receptor-bound protein 7
domestic guinea pig(100725019) growth factor receptor-bound protein 7
naked mole-rat(101704272) growth factor receptor-bound protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005310 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088051 MISSION® esiRNA esiRNA human GRB7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030002 Rosetta Predictions human pricing
NM_005310 Rosetta Predictions human pricing
NM_053403 Rosetta Predictions rat pricing
NM_010346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240616 predicted 1155
2 SASI_Hs01_00240617 predicted 1567
3 SASI_Hs01_00240618 predicted 1525
4 SASI_Hs01_00240619 predicted 248
5 SASI_Hs02_00307622 predicted 1496
6 SASI_Hs01_00240620 predicted 660
7 SASI_Hs01_00240621 predicted 620
8 SASI_Hs01_00240622 predicted 883
9 SASI_Hs01_00240623 predicted 827
10 SASI_Hs01_00240624 predicted 865
11 SASI_Hs01_00240625 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203401 predicted 1299
2 SASI_Hs01_00203402 predicted 1712
3 SASI_Hs01_00203403 predicted 1668
4 SASI_Hs01_00203404 predicted 393
5 SASI_Hs02_00339375 predicted 1640
6 SASI_Hs01_00203405 predicted 806
7 SASI_Hs01_00203406 predicted 769
8 SASI_Hs01_00203407 predicted 1027
9 SASI_Hs01_00203408 predicted 975
10 SASI_Hs01_00203409 predicted 1011
11 SASI_Hs01_00203410 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097639 predicted 1082
2 SASI_Rn01_00097641 predicted 912
3 SASI_Rn01_00097642 predicted 1247
4 SASI_Rn01_00097643 predicted 1916
5 SASI_Rn01_00097644 predicted 456
6 SASI_Rn01_00097645 predicted 1871
7 SASI_Rn01_00097646 predicted 1272
8 SASI_Rn02_00265905 predicted 580
9 SASI_Rn02_00265906 predicted 1052
10 SASI_Rn01_00097648 predicted 1589
11 SASI_Rn01_00097640 predicted 741
12 SASI_Rn01_00097647 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318362 predicted 2052
2 SASI_Mm01_00176230 predicted 422
3 SASI_Mm01_00176232 predicted 1782
4 SASI_Mm01_00176233 predicted 1189
5 SASI_Mm01_00176234 predicted 1527
6 SASI_Mm01_00176235 predicted 1256
7 SASI_Mm02_00318363 predicted 2033
8 SASI_Mm01_00176236 predicted 1536
9 SASI_Mm01_00176237 predicted 1153
10 SASI_Mm02_00318364 predicted 1878
11 SASI_Mm01_00176229 predicted 1275
12 SASI_Mm01_00176231 predicted 1088
13 SASI_Mm01_00176238 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010346
VALIDATED
GRB7 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-2158s21c1
Sequence:CCGGCTCTCTCAACCAGTGAAACATCTCGAGATGTTTCACTGGTTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-647s21c1
Sequence:CCGGCCACCTTCACAGAAACCCATTCTCGAGAATGGGTTTCTGTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-947s21c1
Sequence:CCGGAGCCGCTTCATCTTTCGTAAACTCGAGTTTACGAAAGATGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-973s21c1
Sequence:CCGGCGCCAAGTATGAACTATTCAACTCGAGTTGAATAGTTCATACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-1487s21c1
Sequence:CCGGCACCTGCGCCTATCCTATTTGCTCGAGCAAATAGGATAGGCGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010346.1-2179s1c1
Sequence:CCGGCTCTCTCAACCAGTGAAACATCTCGAGATGTTTCACTGGTTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-995s1c1
Sequence:CCGGCGCCAAGTATGAACTATTCAACTCGAGTTGAATAGTTCATACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-669s1c1
Sequence:CCGGCCACCTTCACAGAAACCCATTCTCGAGAATGGGTTTCTGTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-992s1c1
Sequence:CCGGCTTCGCCAAGTATGAACTATTCTCGAGAATAGTTCATACTTGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010346
VALIDATED
GRB7 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-2158s21c1
Sequence:CCGGCTCTCTCAACCAGTGAAACATCTCGAGATGTTTCACTGGTTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-647s21c1
Sequence:CCGGCCACCTTCACAGAAACCCATTCTCGAGAATGGGTTTCTGTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-947s21c1
Sequence:CCGGAGCCGCTTCATCTTTCGTAAACTCGAGTTTACGAAAGATGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-973s21c1
Sequence:CCGGCGCCAAGTATGAACTATTCAACTCGAGTTGAATAGTTCATACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-1487s21c1
Sequence:CCGGCACCTGCGCCTATCCTATTTGCTCGAGCAAATAGGATAGGCGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010346.1-2179s1c1
Sequence:CCGGCTCTCTCAACCAGTGAAACATCTCGAGATGTTTCACTGGTTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-995s1c1
Sequence:CCGGCGCCAAGTATGAACTATTCAACTCGAGTTGAATAGTTCATACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-669s1c1
Sequence:CCGGCCACCTTCACAGAAACCCATTCTCGAGAATGGGTTTCTGTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-992s1c1
Sequence:CCGGCTTCGCCAAGTATGAACTATTCTCGAGAATAGTTCATACTTGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010346
VALIDATED
GRB7 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-2158s21c1
Sequence:CCGGCTCTCTCAACCAGTGAAACATCTCGAGATGTTTCACTGGTTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-647s21c1
Sequence:CCGGCCACCTTCACAGAAACCCATTCTCGAGAATGGGTTTCTGTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-947s21c1
Sequence:CCGGAGCCGCTTCATCTTTCGTAAACTCGAGTTTACGAAAGATGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-973s21c1
Sequence:CCGGCGCCAAGTATGAACTATTCAACTCGAGTTGAATAGTTCATACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010346.2-1487s21c1
Sequence:CCGGCACCTGCGCCTATCCTATTTGCTCGAGCAAATAGGATAGGCGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010346.1-2179s1c1
Sequence:CCGGCTCTCTCAACCAGTGAAACATCTCGAGATGTTTCACTGGTTGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-995s1c1
Sequence:CCGGCGCCAAGTATGAACTATTCAACTCGAGTTGAATAGTTCATACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-669s1c1
Sequence:CCGGCCACCTTCACAGAAACCCATTCTCGAGAATGGGTTTCTGTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010346.1-992s1c1
Sequence:CCGGCTTCGCCAAGTATGAACTATTCTCGAGAATAGTTCATACTTGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005310
GRB7 MISSION shRNA Bacterial Glycerol Stock
growth factor receptor-bound protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1307s1c1
Sequence:CCGGCCTTGAGAAGTGCCTCAGATACTCGAGTATCTGAGGCACTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-946s1c1
Sequence:CCGGCGGAAGCTTTGGAAACGCTTTCTCGAGAAAGCGTTTCCAAAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1274s1c1
Sequence:CCGGGCCATCTGCATCCATCTTGTTCTCGAGAACAAGATGGATGCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1611s1c1
Sequence:CCGGCCAGGGCTTTGTCCTCTCTTTCTCGAGAAAGAGAGGACAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-774s1c1
Sequence:CCGGCGCCAAGTACGAACTGTTCAACTCGAGTTGAACAGTTCGTACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005310
GRB7 MISSION shRNA shRNA Plasmid DNA
growth factor receptor-bound protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1307s1c1
Sequence:CCGGCCTTGAGAAGTGCCTCAGATACTCGAGTATCTGAGGCACTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-946s1c1
Sequence:CCGGCGGAAGCTTTGGAAACGCTTTCTCGAGAAAGCGTTTCCAAAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1274s1c1
Sequence:CCGGGCCATCTGCATCCATCTTGTTCTCGAGAACAAGATGGATGCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1611s1c1
Sequence:CCGGCCAGGGCTTTGTCCTCTCTTTCTCGAGAAAGAGAGGACAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-774s1c1
Sequence:CCGGCGCCAAGTACGAACTGTTCAACTCGAGTTGAACAGTTCGTACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005310
GRB7 MISSION shRNA Lentiviral Transduction Particles
growth factor receptor-bound protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1307s1c1
Sequence:CCGGCCTTGAGAAGTGCCTCAGATACTCGAGTATCTGAGGCACTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-946s1c1
Sequence:CCGGCGGAAGCTTTGGAAACGCTTTCTCGAGAAAGCGTTTCCAAAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1274s1c1
Sequence:CCGGGCCATCTGCATCCATCTTGTTCTCGAGAACAAGATGGATGCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-1611s1c1
Sequence:CCGGCCAGGGCTTTGTCCTCTCTTTCTCGAGAAAGAGAGGACAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005310.1-774s1c1
Sequence:CCGGCGCCAAGTACGAACTGTTCAACTCGAGTTGAACAGTTCGTACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks