EMAIL THIS PAGE TO A FRIEND

GREB1

growth regulation by estrogen in breast cancer 1

143 Gene Product Result for
Gene ID:
Human(9687) Summary: This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(268527) gene regulated by estrogen in breast cancer protein
Zebrafish(791135) growth regulation by estrogen in breast cancer 1
cow(508204) growth regulation by estrogen in breast cancer 1
Horse(100056879) growth regulation by estrogen in breast cancer 1
domestic cat(101094015) growth regulation by estrogen in breast cancer 1
dog(610007) growth regulation by estrogen in breast cancer 1
chicken(421944) growth regulation by estrogen in breast cancer 1
sheep(101120397) growth regulation by estrogen in breast cancer 1
domestic guinea pig(100713247) growth regulation by estrogen in breast cancer 1
naked mole-rat(101706488) growth regulation by estrogen in breast cancer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014668 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014668 Rosetta Predictions human pricing
NM_033090 Rosetta Predictions human pricing
NM_148903 Rosetta Predictions human pricing
NM_015764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114678 predicted 1183
2 SASI_Hs02_00346011 predicted 1144
3 SASI_Hs01_00114679 predicted 902
4 SASI_Hs01_00114681 predicted 800
5 SASI_Hs02_00346012 predicted 685
6 SASI_Hs02_00346013 predicted 629
7 SASI_Hs02_00346014 predicted 1184
8 SASI_Hs01_00114682 predicted 889
9 SASI_Hs02_00346015 predicted 592
10 SASI_Hs02_00346016 predicted 436
11 SASI_Hs01_00114676 predicted 791
12 SASI_Hs01_00114677 predicted 1151
13 SASI_Hs01_00114680 predicted 1192
14 SASI_Hs01_00114683 predicted 1237
15 SASI_Hs01_00114684 predicted 882
16 SASI_Hs01_00114685 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132406 predicted 1134
2 SASI_Hs02_00360796 predicted 1094
3 SASI_Hs01_00132407 predicted 849
4 SASI_Hs01_00132409 predicted 750
5 SASI_Hs02_00360797 predicted 640
6 SASI_Hs02_00360798 predicted 579
7 SASI_Hs02_00360799 predicted 1131
8 SASI_Hs01_00132410 predicted 849
9 SASI_Hs02_00360800 predicted 534
10 SASI_Hs02_00360801 predicted 388
11 SASI_Hs01_00132404 predicted 745
12 SASI_Hs01_00132405 predicted 1097
13 SASI_Hs01_00132408 predicted 1143
14 SASI_Hs01_00132411 predicted 1191
15 SASI_Hs01_00132412 predicted 829
16 SASI_Hs01_00132413 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109744 predicted 1194
2 SASI_Hs02_00365618 predicted 1161
3 SASI_Hs01_00109745 predicted 916
4 SASI_Hs01_00109747 predicted 819
5 SASI_Hs02_00365619 predicted 700
6 SASI_Hs02_00365620 predicted 644
7 SASI_Hs02_00365621 predicted 1194
8 SASI_Hs01_00109748 predicted 908
9 SASI_Hs02_00365622 predicted 602
10 SASI_Hs02_00365623 predicted 446
11 SASI_Hs01_00109742 predicted 807
12 SASI_Hs01_00109743 predicted 1162
13 SASI_Hs01_00109746 predicted 1209
14 SASI_Hs01_00109749 predicted 1257
15 SASI_Hs01_00109750 predicted 895
16 SASI_Hs01_00109751 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117864 predicted 2325
2 SASI_Mm01_00117865 predicted 5195
3 SASI_Mm02_00323096 predicted 5794
4 SASI_Mm01_00117866 predicted 5604
5 SASI_Mm02_00323097 predicted 3071
6 SASI_Mm01_00117867 predicted 3582
7 SASI_Mm01_00117868 predicted 2539
8 SASI_Mm01_00117869 predicted 5903
9 SASI_Mm01_00117873 predicted 2120
10 SASI_Mm01_00117871 predicted 3661
11 SASI_Mm01_00117870 predicted 3324
12 SASI_Mm01_00117872 predicted 5664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015764
GREB1 MISSION shRNA Bacterial Glycerol Stock
growth regulation by estrogen in breast cancer 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-5374s21c1
Sequence:CCGGTCTGGCCCTTCATCGTCATTGCTCGAGCAATGACGATGAAGGGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.3-3665s1c1
Sequence:CCGGCTACTTTGTTAGCAATGATATCTCGAGATATCATTGCTAACAAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015764.3-6548s21c1
Sequence:CCGGCTATCTTGAAGTCCGTTATATCTCGAGATATAACGGACTTCAAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-5197s21c1
Sequence:CCGGAGTACGAAATGGCCATTTATACTCGAGTATAAATGGCCATTTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-3591s21c1
Sequence:CCGGTACTGTGACCTGCGTCTAATACTCGAGTATTAGACGCAGGTCACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-3665s21c1
Sequence:CCGGCTACTTTGTTAGCAATGATATCTCGAGATATCATTGCTAACAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.1-1439s1c1
Sequence:CCGGCCAGTGATATTTAAAGGCCATCTCGAGATGGCCTTTAAATATCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015764.1-6398s1c1
Sequence:CCGGCGTTATATGCAGAATGAAGTTCTCGAGAACTTCATTCTGCATATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.1-5740s1c1
Sequence:CCGGGCTGGAGAAATTCCTCCAATACTCGAGTATTGGAGGAATTTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015764
GREB1 MISSION shRNA shRNA Plasmid DNA
growth regulation by estrogen in breast cancer 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-5374s21c1
Sequence:CCGGTCTGGCCCTTCATCGTCATTGCTCGAGCAATGACGATGAAGGGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.3-3665s1c1
Sequence:CCGGCTACTTTGTTAGCAATGATATCTCGAGATATCATTGCTAACAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015764.3-6548s21c1
Sequence:CCGGCTATCTTGAAGTCCGTTATATCTCGAGATATAACGGACTTCAAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-5197s21c1
Sequence:CCGGAGTACGAAATGGCCATTTATACTCGAGTATAAATGGCCATTTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-3591s21c1
Sequence:CCGGTACTGTGACCTGCGTCTAATACTCGAGTATTAGACGCAGGTCACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-3665s21c1
Sequence:CCGGCTACTTTGTTAGCAATGATATCTCGAGATATCATTGCTAACAAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.1-1439s1c1
Sequence:CCGGCCAGTGATATTTAAAGGCCATCTCGAGATGGCCTTTAAATATCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015764.1-6398s1c1
Sequence:CCGGCGTTATATGCAGAATGAAGTTCTCGAGAACTTCATTCTGCATATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.1-5740s1c1
Sequence:CCGGGCTGGAGAAATTCCTCCAATACTCGAGTATTGGAGGAATTTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015764
GREB1 MISSION shRNA Lentiviral Transduction Particles
growth regulation by estrogen in breast cancer 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-5374s21c1
Sequence:CCGGTCTGGCCCTTCATCGTCATTGCTCGAGCAATGACGATGAAGGGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.3-3665s1c1
Sequence:CCGGCTACTTTGTTAGCAATGATATCTCGAGATATCATTGCTAACAAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015764.3-6548s21c1
Sequence:CCGGCTATCTTGAAGTCCGTTATATCTCGAGATATAACGGACTTCAAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-5197s21c1
Sequence:CCGGAGTACGAAATGGCCATTTATACTCGAGTATAAATGGCCATTTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-3591s21c1
Sequence:CCGGTACTGTGACCTGCGTCTAATACTCGAGTATTAGACGCAGGTCACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015764.3-3665s21c1
Sequence:CCGGCTACTTTGTTAGCAATGATATCTCGAGATATCATTGCTAACAAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.1-1439s1c1
Sequence:CCGGCCAGTGATATTTAAAGGCCATCTCGAGATGGCCTTTAAATATCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015764.1-6398s1c1
Sequence:CCGGCGTTATATGCAGAATGAAGTTCTCGAGAACTTCATTCTGCATATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015764.1-5740s1c1
Sequence:CCGGGCTGGAGAAATTCCTCCAATACTCGAGTATTGGAGGAATTTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014668
VALIDATED
GREB1 MISSION shRNA Bacterial Glycerol Stock
growth regulation by estrogen in breast cancer 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-6507s21c1
Sequence:CCGGTTTGTAGCGGTGCCAGTATTTCTCGAGAAATACTGGCACCGCTACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-1155s21c1
Sequence:CCGGACTGGCAAAGAATAACCTGTTCTCGAGAACAGGTTATTCTTTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-4777s21c1
Sequence:CCGGGCCTTCTCTTACTCCATGCTACTCGAGTAGCATGGAGTAAGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-2056s21c1
Sequence:CCGGGAAGTCAATTACGAGCTGGTTCTCGAGAACCAGCTCGTAATTGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014668.3-4578s21c1
Sequence:CCGGTTCGCACTATCAGGGTATAAACTCGAGTTTATACCCTGATAGTGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014668.x-6898s1c1
Sequence:CCGGCAAAGGAGAAAGGACCACATTCTCGAGAATGTGGTCCTTTCTCCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-4958s1c1
Sequence:CCGGGTCACGAACATGGGCTCTTTACTCGAGTAAAGAGCCCATGTTCGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-1155s1c1
Sequence:CCGGACTGGCAAAGAATAACCTGTTCTCGAGAACAGGTTATTCTTTGCCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-4777s1c1
Sequence:CCGGGCCTTCTCTTACTCCATGCTACTCGAGTAGCATGGAGTAAGAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-2056s1c1
Sequence:CCGGGAAGTCAATTACGAGCTGGTTCTCGAGAACCAGCTCGTAATTGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014668
VALIDATED
GREB1 MISSION shRNA shRNA Plasmid DNA
growth regulation by estrogen in breast cancer 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-6507s21c1
Sequence:CCGGTTTGTAGCGGTGCCAGTATTTCTCGAGAAATACTGGCACCGCTACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-1155s21c1
Sequence:CCGGACTGGCAAAGAATAACCTGTTCTCGAGAACAGGTTATTCTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-4777s21c1
Sequence:CCGGGCCTTCTCTTACTCCATGCTACTCGAGTAGCATGGAGTAAGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-2056s21c1
Sequence:CCGGGAAGTCAATTACGAGCTGGTTCTCGAGAACCAGCTCGTAATTGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014668.3-4578s21c1
Sequence:CCGGTTCGCACTATCAGGGTATAAACTCGAGTTTATACCCTGATAGTGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014668.x-6898s1c1
Sequence:CCGGCAAAGGAGAAAGGACCACATTCTCGAGAATGTGGTCCTTTCTCCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-4958s1c1
Sequence:CCGGGTCACGAACATGGGCTCTTTACTCGAGTAAAGAGCCCATGTTCGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-1155s1c1
Sequence:CCGGACTGGCAAAGAATAACCTGTTCTCGAGAACAGGTTATTCTTTGCCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-4777s1c1
Sequence:CCGGGCCTTCTCTTACTCCATGCTACTCGAGTAGCATGGAGTAAGAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-2056s1c1
Sequence:CCGGGAAGTCAATTACGAGCTGGTTCTCGAGAACCAGCTCGTAATTGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014668
VALIDATED
GREB1 MISSION shRNA Lentiviral Transduction Particles
growth regulation by estrogen in breast cancer 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-6507s21c1
Sequence:CCGGTTTGTAGCGGTGCCAGTATTTCTCGAGAAATACTGGCACCGCTACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-1155s21c1
Sequence:CCGGACTGGCAAAGAATAACCTGTTCTCGAGAACAGGTTATTCTTTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-4777s21c1
Sequence:CCGGGCCTTCTCTTACTCCATGCTACTCGAGTAGCATGGAGTAAGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014668.3-2056s21c1
Sequence:CCGGGAAGTCAATTACGAGCTGGTTCTCGAGAACCAGCTCGTAATTGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014668.3-4578s21c1
Sequence:CCGGTTCGCACTATCAGGGTATAAACTCGAGTTTATACCCTGATAGTGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014668.x-6898s1c1
Sequence:CCGGCAAAGGAGAAAGGACCACATTCTCGAGAATGTGGTCCTTTCTCCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-4958s1c1
Sequence:CCGGGTCACGAACATGGGCTCTTTACTCGAGTAAAGAGCCCATGTTCGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-1155s1c1
Sequence:CCGGACTGGCAAAGAATAACCTGTTCTCGAGAACAGGTTATTCTTTGCCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-4777s1c1
Sequence:CCGGGCCTTCTCTTACTCCATGCTACTCGAGTAGCATGGAGTAAGAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014668.x-2056s1c1
Sequence:CCGGGAAGTCAATTACGAGCTGGTTCTCGAGAACCAGCTCGTAATTGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)