EMAIL THIS PAGE TO A FRIEND

GREB1L

growth regulation by estrogen in breast cancer-like

111 Gene Product Result for
Synonyms: C18orf6 KIAA1772
UniProtKB ID: Q9C091, A4QN17, Q9H8F1
Gene ID:
Mouse(381157) growth regulation by estrogen in breast cancer-like
Rat(498819) growth regulation by estrogen in breast cancer-like
domestic guinea pig(100722185) growth regulation by estrogen in breast cancer-like
naked mole-rat(101710230) growth regulation by estrogen in breast cancer-like
sheep(101121478) growth regulation by estrogen in breast cancer-like
Zebrafish(100005373) growth regulation by estrogen in breast cancer-like
chicken(421064) growth regulation by estrogen in breast cancer-like
dog(490524) growth regulation by estrogen in breast cancer-like
Horse(100051009) growth regulation by estrogen in breast cancer-like
cow(535053) growth regulation by estrogen in breast cancer-like
domestic cat(101094794) growth regulation by estrogen in breast cancer-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001142966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001083628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001083628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001083628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU192991 MISSION® esiRNA esiRNA targeting mouse Greb1l mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024935 Rosetta Predictions human pricing
XR_040952 Rosetta Predictions human pricing
XR_040953 Rosetta Predictions human pricing
XR_040954 Rosetta Predictions human pricing
XM_001071890 Rosetta Predictions rat pricing
XM_574101 Rosetta Predictions rat pricing
NM_001083628 Rosetta Predictions mouse pricing
XM_977344 Rosetta Predictions mouse pricing
XM_977373 Rosetta Predictions mouse pricing
XM_977405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179135 predicted 1749
2 SASI_Hs01_00179136 predicted 2231
3 SASI_Hs01_00179137 predicted 466
4 SASI_Hs01_00179138 predicted 1462
5 SASI_Hs01_00179139 predicted 839
6 SASI_Hs01_00179140 predicted 834
7 SASI_Hs01_00179141 predicted 980
8 SASI_Hs01_00179142 predicted 955
9 SASI_Hs01_00179143 predicted 1201
10 SASI_Hs01_00179144 predicted 1896
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523332 predicted 2988
2 SASI_Hs02_00523333 predicted 2832
3 SASI_Hs02_00523334 predicted 3797
4 SASI_Hs02_00523335 predicted 5266
5 SASI_Hs02_00523336 predicted 4815
6 SASI_Hs02_00523337 predicted 2301
7 SASI_Hs02_00523338 predicted 714
8 SASI_Hs02_00523339 predicted 4937
9 SASI_Hs02_00523340 predicted 714
10 SASI_Hs02_00523341 predicted 4569
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523342 predicted 2992
2 SASI_Hs02_00523343 predicted 2834
3 SASI_Hs02_00523344 predicted 3793
4 SASI_Hs02_00523345 predicted 5266
5 SASI_Hs02_00523346 predicted 4818
6 SASI_Hs02_00523347 predicted 2305
7 SASI_Hs02_00523348 predicted 720
8 SASI_Hs02_00523349 predicted 4940
9 SASI_Hs02_00523350 predicted 713
10 SASI_Hs02_00523351 predicted 4577
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523352 predicted 2991
2 SASI_Hs02_00523353 predicted 2837
3 SASI_Hs02_00523354 predicted 3793
4 SASI_Hs02_00523355 predicted 5268
5 SASI_Hs02_00523356 predicted 4819
6 SASI_Hs02_00523357 predicted 2308
7 SASI_Hs02_00523358 predicted 718
8 SASI_Hs02_00523359 predicted 4936
9 SASI_Hs02_00523360 predicted 711
10 SASI_Hs02_00523361 predicted 4575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336895 predicted 1156
2 SASI_Rn02_00336896 predicted 954
3 SASI_Rn02_00336897 predicted 1125
4 SASI_Rn02_00336898 predicted 1272
5 SASI_Rn02_00336899 predicted 965
6 SASI_Rn02_00336900 predicted 2289
7 SASI_Rn02_00336901 predicted 2160
8 SASI_Rn02_00336902 predicted 1694
9 SASI_Rn02_00336903 predicted 1804
10 SASI_Rn02_00336904 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401380 predicted 2061
2 SASI_Rn02_00401381 predicted 1851
3 SASI_Rn02_00401382 predicted 868
4 SASI_Rn02_00401383 predicted 567
5 SASI_Rn02_00401384 predicted 367
6 SASI_Rn02_00401385 predicted 561
7 SASI_Rn02_00401386 predicted 3057
8 SASI_Rn02_00401387 predicted 2592
9 SASI_Rn02_00401388 predicted 749
10 SASI_Rn02_00401389 predicted 2707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299741 predicted 1531
2 SASI_Mm02_00299742 predicted 227
3 SASI_Mm02_00299743 predicted 2456
4 SASI_Mm02_00299744 predicted 4473
5 SASI_Mm02_00299745 predicted 405
6 SASI_Mm02_00299746 predicted 3029
7 SASI_Mm02_00299747 predicted 5291
8 SASI_Mm02_00299748 predicted 772
9 SASI_Mm02_00299749 predicted 5840
10 SASI_Mm02_00299750 predicted 3018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241418 predicted 1388
2 SASI_Mm01_00241419 predicted 514
3 SASI_Mm01_00241420 predicted 233
4 SASI_Mm01_00241421 predicted 1276
5 SASI_Mm01_00241422 predicted 1330
6 SASI_Mm01_00241423 predicted 420
7 SASI_Mm01_00241424 predicted 953
8 SASI_Mm01_00241425 predicted 1375
9 SASI_Mm01_00241426 predicted 924
10 SASI_Mm01_00241427 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226795 predicted 1530
2 SASI_Mm01_00226796 predicted 234
3 SASI_Mm01_00226797 predicted 5312
4 SASI_Mm01_00226798 predicted 2462
5 SASI_Mm01_00226799 predicted 4477
6 SASI_Mm01_00226800 predicted 418
7 SASI_Mm01_00226801 predicted 3028
8 SASI_Mm01_00226802 predicted 5300
9 SASI_Mm01_00226803 predicted 776
10 SASI_Mm01_00226804 predicted 3017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252029 predicted 3631
2 SASI_Mm01_00252030 predicted 2565
3 SASI_Mm01_00252031 predicted 2809
4 SASI_Mm01_00252032 predicted 2496
5 SASI_Mm01_00252033 predicted 1356
6 SASI_Mm01_00252034 predicted 3620
7 SASI_Mm01_00252035 predicted 4166
8 SASI_Mm01_00252036 predicted 3783
9 SASI_Mm01_00252037 predicted 1340
10 SASI_Mm01_00252038 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024935
GREB1L MISSION shRNA Bacterial Glycerol Stock
growth regulation by estrogen in breast cancer-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-1493s1c1
Sequence:CCGGCCCTATTTCTATGGAAATGTTCTCGAGAACATTTCCATAGAAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-652s1c1
Sequence:CCGGGCGTTTGGTATCACTGTGTATCTCGAGATACACAGTGATACCAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-320s1c1
Sequence:CCGGGCTCTCCACAACTCCATAGAACTCGAGTTCTATGGAGTTGTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024935.2-3259s1c1
Sequence:CCGGCGGTTAATTGACTCAAGCTATCTCGAGATAGCTTGAGTCAATTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-2228s1c1
Sequence:CCGGGCTGCTATGATTCCCACACAACTCGAGTTGTGTGGGAATCATAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024935
GREB1L MISSION shRNA shRNA Plasmid DNA
growth regulation by estrogen in breast cancer-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-1493s1c1
Sequence:CCGGCCCTATTTCTATGGAAATGTTCTCGAGAACATTTCCATAGAAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-652s1c1
Sequence:CCGGGCGTTTGGTATCACTGTGTATCTCGAGATACACAGTGATACCAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-320s1c1
Sequence:CCGGGCTCTCCACAACTCCATAGAACTCGAGTTCTATGGAGTTGTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024935.2-3259s1c1
Sequence:CCGGCGGTTAATTGACTCAAGCTATCTCGAGATAGCTTGAGTCAATTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-2228s1c1
Sequence:CCGGGCTGCTATGATTCCCACACAACTCGAGTTGTGTGGGAATCATAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024935
GREB1L MISSION shRNA Lentiviral Transduction Particles
growth regulation by estrogen in breast cancer-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-1493s1c1
Sequence:CCGGCCCTATTTCTATGGAAATGTTCTCGAGAACATTTCCATAGAAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-652s1c1
Sequence:CCGGGCGTTTGGTATCACTGTGTATCTCGAGATACACAGTGATACCAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-320s1c1
Sequence:CCGGGCTCTCCACAACTCCATAGAACTCGAGTTCTATGGAGTTGTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024935.2-3259s1c1
Sequence:CCGGCGGTTAATTGACTCAAGCTATCTCGAGATAGCTTGAGTCAATTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024935.2-2228s1c1
Sequence:CCGGGCTGCTATGATTCCCACACAACTCGAGTTGTGTGGGAATCATAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142966
GREB1L MISSION shRNA Bacterial Glycerol Stock
growth regulation by estrogen in breast cancer-like
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000429992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142966.1-3280s21c1
Sequence:CCGGTCACTTTGTGGCGCGATTAAACTCGAGTTTAATCGCGCCACAAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142966
GREB1L MISSION shRNA shRNA Plasmid DNA
growth regulation by estrogen in breast cancer-like
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000429992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142966.1-3280s21c1
Sequence:CCGGTCACTTTGTGGCGCGATTAAACTCGAGTTTAATCGCGCCACAAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142966
GREB1L MISSION shRNA Lentiviral Transduction Particles
growth regulation by estrogen in breast cancer-like
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000429992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142966.1-3280s21c1
Sequence:CCGGTCACTTTGTGGCGCGATTAAACTCGAGTTTAATCGCGCCACAAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083628
VALIDATED
GREB1L MISSION shRNA Bacterial Glycerol Stock
growth regulation by estrogen in breast cancer-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083628.1-5564s21c1
Sequence:CCGGCCTTCAACATGCCTCATATAACTCGAGTTATATGAGGCATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-3390s21c1
Sequence:CCGGTTAATCGACTCAAGCTATTTACTCGAGTAAATAGCTTGAGTCGATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-8138s21c1
Sequence:CCGGGACAGTTCACACAGGTTAATACTCGAGTATTAACCTGTGTGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-4479s21c1
Sequence:CCGGACCCAGTATGCAGCCTATAATCTCGAGATTATAGGCTGCATACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083628
VALIDATED
GREB1L MISSION shRNA shRNA Plasmid DNA
growth regulation by estrogen in breast cancer-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083628.1-5564s21c1
Sequence:CCGGCCTTCAACATGCCTCATATAACTCGAGTTATATGAGGCATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-3390s21c1
Sequence:CCGGTTAATCGACTCAAGCTATTTACTCGAGTAAATAGCTTGAGTCGATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-8138s21c1
Sequence:CCGGGACAGTTCACACAGGTTAATACTCGAGTATTAACCTGTGTGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-4479s21c1
Sequence:CCGGACCCAGTATGCAGCCTATAATCTCGAGATTATAGGCTGCATACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083628
VALIDATED
GREB1L MISSION shRNA Lentiviral Transduction Particles
growth regulation by estrogen in breast cancer-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083628.1-5564s21c1
Sequence:CCGGCCTTCAACATGCCTCATATAACTCGAGTTATATGAGGCATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-3390s21c1
Sequence:CCGGTTAATCGACTCAAGCTATTTACTCGAGTAAATAGCTTGAGTCGATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-8138s21c1
Sequence:CCGGGACAGTTCACACAGGTTAATACTCGAGTATTAACCTGTGTGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001083628.1-4479s21c1
Sequence:CCGGACCCAGTATGCAGCCTATAATCTCGAGATTATAGGCTGCATACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks