EMAIL THIS PAGE TO A FRIEND

GREM1

gremlin 1, DAN family BMP antagonist

80 Gene Product Result for
Synonyms: CKTSF1B1 DAND2 DRM GREMLIN IHG-2
UniProtKB ID: O60565, Q52LV3, Q8N914, Q8N936
Gene ID:
Human(26585) Summary: This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted glycosylated protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to relay the sonic hedgehog (SHH) signal from the polarizing region to the apical ectodermal ridge during limb bud outgrowth. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(23892) gremlin 1
Rat(50566) gremlin 1
chicken(395826) gremlin 1
cow(539079) gremlin 1
dog(487475) gremlin 1
Goat(100860969) gremlin 1
sheep(101102396) gremlin 1
domestic guinea pig(100730568) gremlin 1, DAN family BMP antagonist
naked mole-rat(101720734) gremlin 1, DAN family BMP antagonist
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G4672 Anti-GREM1 (126-140) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA007526 Anti-GREM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1301532 ANTI-GREMLIN (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
WH0026585M4 Monoclonal Anti-GREM1 antibody produced in mouse clone 4C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409100 Monoclonal Anti-GREM1 antibody produced in mouse clone 4D8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409101 Monoclonal Anti-GREM1 antibody produced in mouse clone 3H4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409102 Monoclonal Anti-GREM1 antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409103 Monoclonal Anti-GREM1 antibody produced in mouse clone 2C8, ascites fluid, solution human
ELISA pricing
SAB1409104 Monoclonal Anti-GREM1 antibody produced in mouse clone 2C9, ascites fluid, solution human
ELISA pricing
SAB1405022 Monoclonal Anti-GREM1, (C-terminal) antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013372 Rosetta Predictions human pricing
NM_019282 Rosetta Predictions rat pricing
NM_011824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168262 predicted 261
2 SASI_Hs02_00344714 predicted 1063
3 SASI_Hs02_00344715 predicted 837
4 SASI_Hs02_00344716 predicted 1072
5 SASI_Hs01_00168263 predicted 552
6 SASI_Hs01_00168265 predicted 413
7 SASI_Hs01_00168266 predicted 701
8 SASI_Hs01_00168267 predicted 609
9 SASI_Hs01_00168268 predicted 687
10 SASI_Hs01_00168269 predicted 613
11 SASI_Hs01_00168264 predicted 789
12 SASI_Hs01_00168270 predicted 394
13 SASI_Hs01_00168271 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037788 predicted 386
2 SASI_Rn01_00037790 predicted 461
3 SASI_Rn02_00262210 predicted 1062
4 SASI_Rn01_00037791 predicted 1123
5 SASI_Rn01_00037792 predicted 814
6 SASI_Rn02_00262211 predicted 589
7 SASI_Rn01_00037793 predicted 571
8 SASI_Rn01_00037794 predicted 254
9 SASI_Rn01_00037795 predicted 1172
10 SASI_Rn01_00037796 predicted 753
11 SASI_Rn01_00037789 predicted 1070
12 SASI_Rn01_00037797 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038575 predicted 484
2 SASI_Mm01_00038576 predicted 893
3 SASI_Mm01_00038577 predicted 1189
4 SASI_Mm01_00038579 predicted 829
5 SASI_Mm01_00038580 predicted 770
6 SASI_Mm01_00038581 predicted 920
7 SASI_Mm01_00038582 predicted 1038
8 SASI_Mm01_00038583 predicted 407
9 SASI_Mm01_00038584 predicted 1087
10 SASI_Mm02_00321532 predicted 681
11 SASI_Mm01_00038578 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011824
VALIDATED
GREM1 MISSION shRNA Bacterial Glycerol Stock
gremlin 1, DAN family BMP antagonist
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011824.4-1078s21c1
Sequence:CCGGGTAACTCTGAGGGCTGCATTACTCGAGTAATGCAGCCCTCAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011824.4-940s21c1
Sequence:CCGGTGCTTCAGATGGTCGGAAATGCTCGAGCATTTCCGACCATCTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011824.4-266s21c1
Sequence:CCGGCTGACAAGGCTCAGCACAATGCTCGAGCATTGTGCTGAGCCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011824.4-496s21c1
Sequence:CCGGATCATCAACCGCTTCTGTTATCTCGAGATAACAGAAGCGGTTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-422s1c1
Sequence:CCGGCTGAAGCGAGATTGGTGCAAACTCGAGTTTGCACCAATCTCGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011824.3-771s1c1
Sequence:CCGGCCCGATTCCTACTTGGCTTAACTCGAGTTAAGCCAAGTAGGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011824.3-413s1c1
Sequence:CCGGCGCAAGTATCTGAAGCGAGATCTCGAGATCTCGCTTCAGATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-567s1c1
Sequence:CCGGCCTTTCAGTCTTGCTCCTTCTCTCGAGAGAAGGAGCAAGACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-685s1c1
Sequence:CCGGCCGTTGCATATCCATCGACTTCTCGAGAAGTCGATGGATATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011824
VALIDATED
GREM1 MISSION shRNA shRNA Plasmid DNA
gremlin 1, DAN family BMP antagonist
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011824.4-1078s21c1
Sequence:CCGGGTAACTCTGAGGGCTGCATTACTCGAGTAATGCAGCCCTCAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011824.4-940s21c1
Sequence:CCGGTGCTTCAGATGGTCGGAAATGCTCGAGCATTTCCGACCATCTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011824.4-266s21c1
Sequence:CCGGCTGACAAGGCTCAGCACAATGCTCGAGCATTGTGCTGAGCCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011824.4-496s21c1
Sequence:CCGGATCATCAACCGCTTCTGTTATCTCGAGATAACAGAAGCGGTTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-422s1c1
Sequence:CCGGCTGAAGCGAGATTGGTGCAAACTCGAGTTTGCACCAATCTCGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011824.3-771s1c1
Sequence:CCGGCCCGATTCCTACTTGGCTTAACTCGAGTTAAGCCAAGTAGGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011824.3-413s1c1
Sequence:CCGGCGCAAGTATCTGAAGCGAGATCTCGAGATCTCGCTTCAGATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-567s1c1
Sequence:CCGGCCTTTCAGTCTTGCTCCTTCTCTCGAGAGAAGGAGCAAGACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-685s1c1
Sequence:CCGGCCGTTGCATATCCATCGACTTCTCGAGAAGTCGATGGATATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011824
VALIDATED
GREM1 MISSION shRNA Lentiviral Transduction Particles
gremlin 1, DAN family BMP antagonist
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011824.4-1078s21c1
Sequence:CCGGGTAACTCTGAGGGCTGCATTACTCGAGTAATGCAGCCCTCAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011824.4-940s21c1
Sequence:CCGGTGCTTCAGATGGTCGGAAATGCTCGAGCATTTCCGACCATCTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011824.4-266s21c1
Sequence:CCGGCTGACAAGGCTCAGCACAATGCTCGAGCATTGTGCTGAGCCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011824.4-496s21c1
Sequence:CCGGATCATCAACCGCTTCTGTTATCTCGAGATAACAGAAGCGGTTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-422s1c1
Sequence:CCGGCTGAAGCGAGATTGGTGCAAACTCGAGTTTGCACCAATCTCGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011824.3-771s1c1
Sequence:CCGGCCCGATTCCTACTTGGCTTAACTCGAGTTAAGCCAAGTAGGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011824.3-413s1c1
Sequence:CCGGCGCAAGTATCTGAAGCGAGATCTCGAGATCTCGCTTCAGATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-567s1c1
Sequence:CCGGCCTTTCAGTCTTGCTCCTTCTCTCGAGAGAAGGAGCAAGACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011824.3-685s1c1
Sequence:CCGGCCGTTGCATATCCATCGACTTCTCGAGAAGTCGATGGATATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013372
GREM1 MISSION shRNA Bacterial Glycerol Stock
gremlin 1, DAN family BMP antagonist
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013372.5-424s21c1
Sequence:CCGGCTGAAGCGAGACTGGTGCAAACTCGAGTTTGCACCAGTCTCGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013372.5-619s21c1
Sequence:CCGGGTCACACTCAACTGCCCTGAACTCGAGTTCAGGGCAGTTGAGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-584s1c1
Sequence:CCGGGCAGTGTCGTTGCATATCCATCTCGAGATGGATATGCAACGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-545s1c1
Sequence:CCGGACAGCCACCTACCAAGAAGAACTCGAGTTCTTCTTGGTAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-168s1c1
Sequence:CCGGCCAGACAAGGCCCAGCACAATCTCGAGATTGTGCTGGGCCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-386s1c1
Sequence:CCGGCAACAGTCGCACCATCATCAACTCGAGTTGATGATGGTGCGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-500s1c1
Sequence:CCGGCAAGAAATTCACTACCATGATCTCGAGATCATGGTAGTGAATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013372
GREM1 MISSION shRNA shRNA Plasmid DNA
gremlin 1, DAN family BMP antagonist
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013372.5-424s21c1
Sequence:CCGGCTGAAGCGAGACTGGTGCAAACTCGAGTTTGCACCAGTCTCGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013372.5-619s21c1
Sequence:CCGGGTCACACTCAACTGCCCTGAACTCGAGTTCAGGGCAGTTGAGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-584s1c1
Sequence:CCGGGCAGTGTCGTTGCATATCCATCTCGAGATGGATATGCAACGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-545s1c1
Sequence:CCGGACAGCCACCTACCAAGAAGAACTCGAGTTCTTCTTGGTAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-168s1c1
Sequence:CCGGCCAGACAAGGCCCAGCACAATCTCGAGATTGTGCTGGGCCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-386s1c1
Sequence:CCGGCAACAGTCGCACCATCATCAACTCGAGTTGATGATGGTGCGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-500s1c1
Sequence:CCGGCAAGAAATTCACTACCATGATCTCGAGATCATGGTAGTGAATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013372
GREM1 MISSION shRNA Lentiviral Transduction Particles
gremlin 1, DAN family BMP antagonist
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013372.5-424s21c1
Sequence:CCGGCTGAAGCGAGACTGGTGCAAACTCGAGTTTGCACCAGTCTCGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013372.5-619s21c1
Sequence:CCGGGTCACACTCAACTGCCCTGAACTCGAGTTCAGGGCAGTTGAGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-584s1c1
Sequence:CCGGGCAGTGTCGTTGCATATCCATCTCGAGATGGATATGCAACGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-545s1c1
Sequence:CCGGACAGCCACCTACCAAGAAGAACTCGAGTTCTTCTTGGTAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-168s1c1
Sequence:CCGGCCAGACAAGGCCCAGCACAATCTCGAGATTGTGCTGGGCCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-386s1c1
Sequence:CCGGCAACAGTCGCACCATCATCAACTCGAGTTGATGATGGTGCGACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013372.4-500s1c1
Sequence:CCGGCAAGAAATTCACTACCATGATCTCGAGATCATGGTAGTGAATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks