EMAIL THIS PAGE TO A FRIEND

GREM2

gremlin 2, DAN family BMP antagonist

125 Gene Product Result for
Synonyms: CKTSF1B2 DAND3 PRDC
UniProtKB ID: Q9H772, Q86UD9
Gene ID:
Human(64388) Summary: This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted glycosylated protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. [provided by RefSeq, Jul 2008]
Mouse(23893) gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis)
Rat(289264) gremlin 2
Zebrafish(550399) gremlin 2, cysteine knot superfamily
chicken(421507) gremlin 2
dog(490367) gremlin 2
domestic guinea pig(100731124) gremlin 2, DAN family BMP antagonist
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0838 Mouse Grem2 / Gremlin-2 ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022469 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026201 MISSION® esiRNA esiRNA targeting mouse Grem2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022469 Rosetta Predictions human pricing
NM_001105974 Rosetta Predictions rat pricing
NM_011825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176411 predicted 1100
2 SASI_Hs01_00176412 predicted 895
3 SASI_Hs02_00355743 predicted 1022
4 SASI_Hs01_00176413 predicted 908
5 SASI_Hs01_00176414 predicted 403
6 SASI_Hs01_00176415 predicted 1187
7 SASI_Hs02_00355744 predicted 1015
8 SASI_Hs01_00176416 predicted 473
9 SASI_Hs01_00176417 predicted 1103
10 SASI_Hs01_00176418 predicted 960
11 SASI_Hs01_00176410 predicted 1085
12 SASI_Hs01_00176419 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214382 predicted 944
2 SASI_Rn02_00214383 predicted 850
3 SASI_Rn02_00214384 predicted 872
4 SASI_Rn02_00214385 predicted 953
5 SASI_Rn02_00214386 predicted 632
6 SASI_Rn02_00214387 predicted 995
7 SASI_Rn02_00214388 predicted 826
8 SASI_Rn02_00214389 predicted 286
9 SASI_Rn02_00214390 predicted 1049
10 SASI_Rn02_00214391 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071872 predicted 942
2 SASI_Mm01_00071874 predicted 1034
3 SASI_Mm02_00321533 predicted 374
4 SASI_Mm01_00071875 predicted 849
5 SASI_Mm01_00071876 predicted 808
6 SASI_Mm01_00071877 predicted 765
7 SASI_Mm01_00071878 predicted 1054
8 SASI_Mm01_00071880 predicted 965
9 SASI_Mm02_00321534 predicted 1039
10 SASI_Mm02_00321535 predicted 419
11 SASI_Mm01_00071871 predicted 1254
12 SASI_Mm01_00071873 predicted 519
13 SASI_Mm01_00071879 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011825
GREM2 MISSION shRNA Bacterial Glycerol Stock
gremlin 2, DAN family BMP antagonist
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011825.1-350s1c1
Sequence:CCGGCAAGGATGGTAGCAGCAACAACTCGAGTTGTTGCTGCTACCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011825.1-672s1c1
Sequence:CCGGCCACCTTTCCGAATCAAGAAACTCGAGTTTCTTGATTCGGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-638s21c1
Sequence:CCGGTGTCATCGTAGAGCTCGAATGCTCGAGCATTCGAGCTCTACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011825.1-2026s21c1
Sequence:CCGGGCCAATATAGAGGGTAGTAATCTCGAGATTACTACCCTCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-669s21c1
Sequence:CCGGGACCCACCTTTCCGAATCAAGCTCGAGCTTGATTCGGAAAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-290s21c1
Sequence:CCGGGCTGGTAAAGGTAGCTGAAACCTCGAGGTTTCAGCTACCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-595s21c1
Sequence:CCGGCCTTCCAATCCTGCGCTTTCTCTCGAGAGAAAGCGCAGGATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011825
GREM2 MISSION shRNA shRNA Plasmid DNA
gremlin 2, DAN family BMP antagonist
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011825.1-350s1c1
Sequence:CCGGCAAGGATGGTAGCAGCAACAACTCGAGTTGTTGCTGCTACCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011825.1-672s1c1
Sequence:CCGGCCACCTTTCCGAATCAAGAAACTCGAGTTTCTTGATTCGGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-638s21c1
Sequence:CCGGTGTCATCGTAGAGCTCGAATGCTCGAGCATTCGAGCTCTACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011825.1-2026s21c1
Sequence:CCGGGCCAATATAGAGGGTAGTAATCTCGAGATTACTACCCTCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-669s21c1
Sequence:CCGGGACCCACCTTTCCGAATCAAGCTCGAGCTTGATTCGGAAAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-290s21c1
Sequence:CCGGGCTGGTAAAGGTAGCTGAAACCTCGAGGTTTCAGCTACCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-595s21c1
Sequence:CCGGCCTTCCAATCCTGCGCTTTCTCTCGAGAGAAAGCGCAGGATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011825
GREM2 MISSION shRNA Lentiviral Transduction Particles
gremlin 2, DAN family BMP antagonist
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011825.1-350s1c1
Sequence:CCGGCAAGGATGGTAGCAGCAACAACTCGAGTTGTTGCTGCTACCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011825.1-672s1c1
Sequence:CCGGCCACCTTTCCGAATCAAGAAACTCGAGTTTCTTGATTCGGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-638s21c1
Sequence:CCGGTGTCATCGTAGAGCTCGAATGCTCGAGCATTCGAGCTCTACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011825.1-2026s21c1
Sequence:CCGGGCCAATATAGAGGGTAGTAATCTCGAGATTACTACCCTCTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-669s21c1
Sequence:CCGGGACCCACCTTTCCGAATCAAGCTCGAGCTTGATTCGGAAAGGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-290s21c1
Sequence:CCGGGCTGGTAAAGGTAGCTGAAACCTCGAGGTTTCAGCTACCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011825.1-595s21c1
Sequence:CCGGCCTTCCAATCCTGCGCTTTCTCTCGAGAGAAAGCGCAGGATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022469
GREM2 MISSION shRNA Bacterial Glycerol Stock
gremlin 2, DAN family BMP antagonist
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022469.2-505s1c1
Sequence:CCGGCCAGTGCAACTCCTTCTACATCTCGAGATGTAGAAGGAGTTGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2533s1c1
Sequence:CCGGCAAGGTGCATTTCTGTCATTTCTCGAGAAATGACAGAAATGCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-1783s1c1
Sequence:CCGGGCACAATGTAGAAATTGGCTTCTCGAGAAGCCAATTTCTACATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150961    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-2785s1c1
Sequence:CCGGGCTGTGAAGGAAGGAAATTTACTCGAGTAAATTTCCTTCCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-1459s1c1
Sequence:CCGGGCATGCTATTATTGCTGCAATCTCGAGATTGCAGCAATAATAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2182s1c1
Sequence:CCGGCGGAAGTAGACGTAACTTATTCTCGAGAATAAGTTACGTCTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2290s1c1
Sequence:CCGGCAAATGTGAATGAGCTGCCATCTCGAGATGGCAGCTCATTCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-1280s1c1
Sequence:CCGGGCGTCTCCTAATAAACCTGATCTCGAGATCAGGTTTATTAGGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2532s1c1
Sequence:CCGGGCAAGGTGCATTTCTGTCATTCTCGAGAATGACAGAAATGCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-2545s1c1
Sequence:CCGGCTGTCATTTCTGCAACACCATCTCGAGATGGTGTTGCAGAAATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022469
GREM2 MISSION shRNA shRNA Plasmid DNA
gremlin 2, DAN family BMP antagonist
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022469.2-505s1c1
Sequence:CCGGCCAGTGCAACTCCTTCTACATCTCGAGATGTAGAAGGAGTTGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2533s1c1
Sequence:CCGGCAAGGTGCATTTCTGTCATTTCTCGAGAAATGACAGAAATGCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-1783s1c1
Sequence:CCGGGCACAATGTAGAAATTGGCTTCTCGAGAAGCCAATTTCTACATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150961    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-2785s1c1
Sequence:CCGGGCTGTGAAGGAAGGAAATTTACTCGAGTAAATTTCCTTCCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-1459s1c1
Sequence:CCGGGCATGCTATTATTGCTGCAATCTCGAGATTGCAGCAATAATAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2182s1c1
Sequence:CCGGCGGAAGTAGACGTAACTTATTCTCGAGAATAAGTTACGTCTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2290s1c1
Sequence:CCGGCAAATGTGAATGAGCTGCCATCTCGAGATGGCAGCTCATTCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-1280s1c1
Sequence:CCGGGCGTCTCCTAATAAACCTGATCTCGAGATCAGGTTTATTAGGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2532s1c1
Sequence:CCGGGCAAGGTGCATTTCTGTCATTCTCGAGAATGACAGAAATGCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-2545s1c1
Sequence:CCGGCTGTCATTTCTGCAACACCATCTCGAGATGGTGTTGCAGAAATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022469
GREM2 MISSION shRNA Lentiviral Transduction Particles
gremlin 2, DAN family BMP antagonist
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022469.2-505s1c1
Sequence:CCGGCCAGTGCAACTCCTTCTACATCTCGAGATGTAGAAGGAGTTGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2533s1c1
Sequence:CCGGCAAGGTGCATTTCTGTCATTTCTCGAGAAATGACAGAAATGCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-1783s1c1
Sequence:CCGGGCACAATGTAGAAATTGGCTTCTCGAGAAGCCAATTTCTACATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150961    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-2785s1c1
Sequence:CCGGGCTGTGAAGGAAGGAAATTTACTCGAGTAAATTTCCTTCCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-1459s1c1
Sequence:CCGGGCATGCTATTATTGCTGCAATCTCGAGATTGCAGCAATAATAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2182s1c1
Sequence:CCGGCGGAAGTAGACGTAACTTATTCTCGAGAATAAGTTACGTCTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2290s1c1
Sequence:CCGGCAAATGTGAATGAGCTGCCATCTCGAGATGGCAGCTCATTCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-1280s1c1
Sequence:CCGGGCGTCTCCTAATAAACCTGATCTCGAGATCAGGTTTATTAGGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022469.2-2532s1c1
Sequence:CCGGGCAAGGTGCATTTCTGTCATTCTCGAGAATGACAGAAATGCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022469.2-2545s1c1
Sequence:CCGGCTGTCATTTCTGCAACACCATCTCGAGATGGTGTTGCAGAAATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks