EMAIL THIS PAGE TO A FRIEND

GRHL2

grainyhead-like 2 (Drosophila)

100 Gene Product Result for
Synonyms: BOM DFNA28 TFCP2L3
UniProtKB ID: Q6ISB3, A1L303, Q6NT03, Q9H8B8
Gene ID:
Human(79977) Summary: The protein encoded by this gene is a transcription factor that can act as a homodimer or as a heterodimer with either GRHL1 or GRHL3. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal dominant type 28 (DFNA28).[provided by RefSeq, Mar 2009]
Mouse(252973) grainyhead-like 2 (Drosophila)
Rat(299979) grainyhead-like 2 (Drosophila)
domestic guinea pig(100721393) grainyhead-like 2 (Drosophila)
naked mole-rat(101716381) grainyhead-like 2 (Drosophila)
sheep(101102496) grainyhead-like 2 (Drosophila)
chicken(429506) grainyhead-like 2 (Drosophila)
dog(481985) grainyhead-like 2 (Drosophila)
domestic cat(101099273) grainyhead-like 2 (Drosophila)
cow(519918) grainyhead-like 2 (Drosophila)
Horse(100056140) grainyhead-like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024915 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024915 Rosetta Predictions human pricing
NM_001134527 Rosetta Predictions rat pricing
NM_026496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357526 predicted 334
2 SASI_Hs01_00214880 predicted 1515
3 SASI_Hs02_00357527 predicted 2000
4 SASI_Hs01_00214881 predicted 1365
5 SASI_Hs01_00214882 predicted 1328
6 SASI_Hs02_00357528 predicted 480
7 SASI_Hs01_00214884 predicted 1545
8 SASI_Hs01_00214885 predicted 1404
9 SASI_Hs02_00357529 predicted 689
10 SASI_Hs01_00214886 predicted 1029
11 SASI_Hs01_00214883 predicted 382
12 SASI_Hs01_00214887 predicted 1987
13 SASI_Hs01_00214888 predicted 1494
14 SASI_Hs01_00214889 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256759 predicted 1027
2 SASI_Rn02_00256760 predicted 543
3 SASI_Rn02_00256761 predicted 1294
4 SASI_Rn02_00256762 predicted 1468
5 SASI_Rn02_00256763 predicted 1704
6 SASI_Rn02_00256764 predicted 1134
7 SASI_Rn02_00256765 predicted 890
8 SASI_Rn02_00256766 predicted 1222
9 SASI_Rn02_00256767 predicted 1283
10 SASI_Rn02_00256768 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189314 predicted 1245
2 SASI_Mm01_00189315 predicted 1925
3 SASI_Mm01_00189316 predicted 1582
4 SASI_Mm02_00330385 predicted 1953
5 SASI_Mm01_00189318 predicted 1323
6 SASI_Mm01_00189319 predicted 517
7 SASI_Mm01_00189320 predicted 1075
8 SASI_Mm01_00189321 predicted 1692
9 SASI_Mm01_00189322 predicted 1716
10 SASI_Mm01_00189323 predicted 1246
11 SASI_Mm01_00189317 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026496
VALIDATED
GRHL2 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-814s1c1
Sequence:CCGGCGGAGAAATTTCGGAGTACTTCTCGAGAAGTACTCCGAAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-1907s1c1
Sequence:CCGGCCTGGTCAACATGGATGACAACTCGAGTTGTCATCCATGTTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026496.1-1190s1c1
Sequence:CCGGCGCATACAATGCTGTTTCCTTCTCGAGAAGGAAACAGCATTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-1664s1c1
Sequence:CCGGCGTCCTTGTTAAGCGGATGTTCTCGAGAACATCCGCTTAACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026496.1-947s1c1
Sequence:CCGGCCTCAACAAAGGACAATTCTACTCGAGTAGAATTGTCCTTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026496.3-1714s21c1
Sequence:CCGGCACCGTCTAAGCAGATCAAAGCTCGAGCTTTGATCTGCTTAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026496.3-1664s21c1
Sequence:CCGGCGTCCTTGTTAAGCGGATGTTCTCGAGAACATCCGCTTAACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026496.3-1907s21c1
Sequence:CCGGCCTGGTCAACATGGATGACAACTCGAGTTGTCATCCATGTTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026496.3-2244s21c1
Sequence:CCGGGAGCCTGGTAGGCCCTTATTTCTCGAGAAATAAGGGCCTACCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026496.3-439s21c1
Sequence:CCGGCCAGTGAAGCCCAGATCAATTCTCGAGAATTGATCTGGGCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026496
VALIDATED
GRHL2 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-814s1c1
Sequence:CCGGCGGAGAAATTTCGGAGTACTTCTCGAGAAGTACTCCGAAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-1907s1c1
Sequence:CCGGCCTGGTCAACATGGATGACAACTCGAGTTGTCATCCATGTTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026496.1-1190s1c1
Sequence:CCGGCGCATACAATGCTGTTTCCTTCTCGAGAAGGAAACAGCATTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-1664s1c1
Sequence:CCGGCGTCCTTGTTAAGCGGATGTTCTCGAGAACATCCGCTTAACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026496.1-947s1c1
Sequence:CCGGCCTCAACAAAGGACAATTCTACTCGAGTAGAATTGTCCTTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026496.3-1714s21c1
Sequence:CCGGCACCGTCTAAGCAGATCAAAGCTCGAGCTTTGATCTGCTTAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026496.3-1664s21c1
Sequence:CCGGCGTCCTTGTTAAGCGGATGTTCTCGAGAACATCCGCTTAACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026496.3-1907s21c1
Sequence:CCGGCCTGGTCAACATGGATGACAACTCGAGTTGTCATCCATGTTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026496.3-2244s21c1
Sequence:CCGGGAGCCTGGTAGGCCCTTATTTCTCGAGAAATAAGGGCCTACCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026496.3-439s21c1
Sequence:CCGGCCAGTGAAGCCCAGATCAATTCTCGAGAATTGATCTGGGCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026496
VALIDATED
GRHL2 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-814s1c1
Sequence:CCGGCGGAGAAATTTCGGAGTACTTCTCGAGAAGTACTCCGAAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-1907s1c1
Sequence:CCGGCCTGGTCAACATGGATGACAACTCGAGTTGTCATCCATGTTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026496.1-1190s1c1
Sequence:CCGGCGCATACAATGCTGTTTCCTTCTCGAGAAGGAAACAGCATTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026496.1-1664s1c1
Sequence:CCGGCGTCCTTGTTAAGCGGATGTTCTCGAGAACATCCGCTTAACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026496.1-947s1c1
Sequence:CCGGCCTCAACAAAGGACAATTCTACTCGAGTAGAATTGTCCTTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026496.3-1714s21c1
Sequence:CCGGCACCGTCTAAGCAGATCAAAGCTCGAGCTTTGATCTGCTTAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026496.3-1664s21c1
Sequence:CCGGCGTCCTTGTTAAGCGGATGTTCTCGAGAACATCCGCTTAACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026496.3-1907s21c1
Sequence:CCGGCCTGGTCAACATGGATGACAACTCGAGTTGTCATCCATGTTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026496.3-2244s21c1
Sequence:CCGGGAGCCTGGTAGGCCCTTATTTCTCGAGAAATAAGGGCCTACCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026496.3-439s21c1
Sequence:CCGGCCAGTGAAGCCCAGATCAATTCTCGAGAATTGATCTGGGCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024915
GRHL2 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 2 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-1015s1c1
Sequence:CCGGGCCGATTACAAGGAGAGCTTTCTCGAGAAAGCTCTCCTTGTAATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-373s1c1
Sequence:CCGGCCAGTGAACCTTTCCCTAAATCTCGAGATTTAGGGAAAGGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-490s1c1
Sequence:CCGGGCTGAAGATTTCACACCAGTTCTCGAGAACTGGTGTGAAATCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-1588s1c1
Sequence:CCGGCCTTCAAAGCAGATGAAAGAACTCGAGTTCTTTCATCTGCTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024915.3-2647s21c1
Sequence:CCGGACGTCTGGGTGCAGTAGTTATCTCGAGATAACTACTGCACCCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024915.3-1055s21c1
Sequence:CCGGAGACATCAAGTGGCACATTTCCTCGAGGAAATGTGCCACTTGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024915
GRHL2 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 2 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-1015s1c1
Sequence:CCGGGCCGATTACAAGGAGAGCTTTCTCGAGAAAGCTCTCCTTGTAATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-373s1c1
Sequence:CCGGCCAGTGAACCTTTCCCTAAATCTCGAGATTTAGGGAAAGGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-490s1c1
Sequence:CCGGGCTGAAGATTTCACACCAGTTCTCGAGAACTGGTGTGAAATCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-1588s1c1
Sequence:CCGGCCTTCAAAGCAGATGAAAGAACTCGAGTTCTTTCATCTGCTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024915.3-2647s21c1
Sequence:CCGGACGTCTGGGTGCAGTAGTTATCTCGAGATAACTACTGCACCCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024915.3-1055s21c1
Sequence:CCGGAGACATCAAGTGGCACATTTCCTCGAGGAAATGTGCCACTTGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024915
GRHL2 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 2 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-1015s1c1
Sequence:CCGGGCCGATTACAAGGAGAGCTTTCTCGAGAAAGCTCTCCTTGTAATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-373s1c1
Sequence:CCGGCCAGTGAACCTTTCCCTAAATCTCGAGATTTAGGGAAAGGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-490s1c1
Sequence:CCGGGCTGAAGATTTCACACCAGTTCTCGAGAACTGGTGTGAAATCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024915.1-1588s1c1
Sequence:CCGGCCTTCAAAGCAGATGAAAGAACTCGAGTTCTTTCATCTGCTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024915.3-2647s21c1
Sequence:CCGGACGTCTGGGTGCAGTAGTTATCTCGAGATAACTACTGCACCCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024915.3-1055s21c1
Sequence:CCGGAGACATCAAGTGGCACATTTCCTCGAGGAAATGTGCCACTTGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks