EMAIL THIS PAGE TO A FRIEND

GRHL3

grainyhead-like 3 (Drosophila)

94 Gene Product Result for
Synonyms: SOM TFCP2L4
Gene ID:
Human(57822) Summary: This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
Mouse(230824) grainyhead-like 3 (Drosophila)
Rat(298555) grainyhead-like 3 (Drosophila)
Zebrafish(794613) grainyhead-like 3
cow(531906) grainyhead-like 3 (Drosophila)
Horse(100057567) grainyhead-like 3 (Drosophila)
domestic cat(101100984) grainyhead-like 3 (Drosophila)
dog(487371) grainyhead-like 3 (Drosophila)
chicken(419695) grainyhead-like 3 (Drosophila)
sheep(101117909) grainyhead-like 3 (Drosophila)
Domestic Rabbit(100356381) grainyhead-like 3 (Drosophila)
domestic guinea pig(100720149) grainyhead-like 3 (Drosophila)
naked mole-rat(101722201) grainyhead-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021180 Rosetta Predictions human pricing
NM_198173 Rosetta Predictions human pricing
NM_198174 Rosetta Predictions human pricing
NM_001106690 Rosetta Predictions rat pricing
NM_001013756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156497 predicted 784
2 SASI_Hs01_00156498 predicted 547
3 SASI_Hs01_00156499 predicted 1099
4 SASI_Hs01_00156500 predicted 586
5 SASI_Hs01_00156501 predicted 1174
6 SASI_Hs01_00156502 predicted 1119
7 SASI_Hs01_00156503 predicted 1061
8 SASI_Hs01_00156504 predicted 1038
9 SASI_Hs01_00156505 predicted 878
10 SASI_Hs01_00156506 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179025 predicted 876
2 SASI_Hs01_00179026 predicted 646
3 SASI_Hs01_00179027 predicted 1200
4 SASI_Hs01_00179028 predicted 679
5 SASI_Hs01_00179029 predicted 1283
6 SASI_Hs01_00179030 predicted 1216
7 SASI_Hs01_00179031 predicted 1155
8 SASI_Hs01_00179032 predicted 1140
9 SASI_Hs01_00179033 predicted 987
10 SASI_Hs01_00179034 predicted 1732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018544 predicted 597
2 SASI_Hs01_00018545 predicted 357
3 SASI_Hs01_00018546 predicted 916
4 SASI_Hs01_00018547 predicted 396
5 SASI_Hs01_00018548 predicted 989
6 SASI_Hs01_00018549 predicted 927
7 SASI_Hs01_00018550 predicted 865
8 SASI_Hs01_00018551 predicted 852
9 SASI_Hs01_00018552 predicted 698
10 SASI_Hs01_00018553 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221428 predicted 1068
2 SASI_Rn02_00221429 predicted 1158
3 SASI_Rn02_00221430 predicted 1792
4 SASI_Rn02_00221431 predicted 973
5 SASI_Rn02_00221432 predicted 809
6 SASI_Rn02_00221433 predicted 1485
7 SASI_Rn02_00221434 predicted 951
8 SASI_Rn02_00221435 predicted 996
9 SASI_Rn02_00221436 predicted 1241
10 SASI_Rn02_00221437 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160597 predicted 1852
2 SASI_Mm01_00160598 predicted 1720
3 SASI_Mm02_00287286 predicted 1310
4 SASI_Mm01_00160599 predicted 715
5 SASI_Mm01_00160600 predicted 2070
6 SASI_Mm01_00160601 predicted 250
7 SASI_Mm01_00160602 predicted 307
8 SASI_Mm01_00160603 predicted 449
9 SASI_Mm01_00160604 predicted 1768
10 SASI_Mm01_00160605 predicted 1465
11 SASI_Mm01_00160606 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021180
GRHL3 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 3 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-1105s21c1
Sequence:CCGGCAAGGTGTTCATCGGCGTAAACTCGAGTTTACGCCGATGAACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-329s21c1
Sequence:CCGGTACTACCATGGCATGGAATATCTCGAGATATTCCATGCCATGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-269s21c1
Sequence:CCGGCCCAAGGAGAAGCGGATATTGCTCGAGCAATATCCGCTTCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-909s21c1
Sequence:CCGGTGATGGTTGTCTTCGACAATGCTCGAGCATTGTCGAAGACAACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-1750s1c1
Sequence:CCGGGCGAGGAATCTTAGTCAACATCTCGAGATGTTGACTAAGATTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-439s1c1
Sequence:CCGGGCTCAAGAAGAATAACCTGATCTCGAGATCAGGTTATTCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-1712s1c1
Sequence:CCGGCCTGAAGAGAACATTTACAAACTCGAGTTTGTAAATGTTCTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-236s1c1
Sequence:CCGGGCCTTGAGCTTCCTCTATGATCTCGAGATCATAGAGGAAGCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-558s1c1
Sequence:CCGGCCACCACTGATATGTATGATACTCGAGTATCATACATATCAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021180
GRHL3 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 3 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-1105s21c1
Sequence:CCGGCAAGGTGTTCATCGGCGTAAACTCGAGTTTACGCCGATGAACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-329s21c1
Sequence:CCGGTACTACCATGGCATGGAATATCTCGAGATATTCCATGCCATGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-269s21c1
Sequence:CCGGCCCAAGGAGAAGCGGATATTGCTCGAGCAATATCCGCTTCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-909s21c1
Sequence:CCGGTGATGGTTGTCTTCGACAATGCTCGAGCATTGTCGAAGACAACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-1750s1c1
Sequence:CCGGGCGAGGAATCTTAGTCAACATCTCGAGATGTTGACTAAGATTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-439s1c1
Sequence:CCGGGCTCAAGAAGAATAACCTGATCTCGAGATCAGGTTATTCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-1712s1c1
Sequence:CCGGCCTGAAGAGAACATTTACAAACTCGAGTTTGTAAATGTTCTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-236s1c1
Sequence:CCGGGCCTTGAGCTTCCTCTATGATCTCGAGATCATAGAGGAAGCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-558s1c1
Sequence:CCGGCCACCACTGATATGTATGATACTCGAGTATCATACATATCAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021180
GRHL3 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 3 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-1105s21c1
Sequence:CCGGCAAGGTGTTCATCGGCGTAAACTCGAGTTTACGCCGATGAACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-329s21c1
Sequence:CCGGTACTACCATGGCATGGAATATCTCGAGATATTCCATGCCATGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-269s21c1
Sequence:CCGGCCCAAGGAGAAGCGGATATTGCTCGAGCAATATCCGCTTCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021180.2-909s21c1
Sequence:CCGGTGATGGTTGTCTTCGACAATGCTCGAGCATTGTCGAAGACAACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-1750s1c1
Sequence:CCGGGCGAGGAATCTTAGTCAACATCTCGAGATGTTGACTAAGATTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-439s1c1
Sequence:CCGGGCTCAAGAAGAATAACCTGATCTCGAGATCAGGTTATTCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-1712s1c1
Sequence:CCGGCCTGAAGAGAACATTTACAAACTCGAGTTTGTAAATGTTCTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-236s1c1
Sequence:CCGGGCCTTGAGCTTCCTCTATGATCTCGAGATCATAGAGGAAGCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021180.2-558s1c1
Sequence:CCGGCCACCACTGATATGTATGATACTCGAGTATCATACATATCAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013756
GRHL3 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013756.1-2498s1c1
Sequence:CCGGGCACAAGATGTAAGTCACCATCTCGAGATGGTGACTTACATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-873s1c1
Sequence:CCGGGCCTCAAGAGTGACTTTGAATCTCGAGATTCAAAGTCACTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-1897s1c1
Sequence:CCGGCCTGGTTAACATGGACAACAACTCGAGTTGTTGTCCATGTTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-256s1c1
Sequence:CCGGCCAGAAGTTTCCCTACAGTAACTCGAGTTACTGTAGGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-388s1c1
Sequence:CCGGCGACTACTATATGGGTCCCAACTCGAGTTGGGACCCATATAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013756
GRHL3 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013756.1-2498s1c1
Sequence:CCGGGCACAAGATGTAAGTCACCATCTCGAGATGGTGACTTACATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-873s1c1
Sequence:CCGGGCCTCAAGAGTGACTTTGAATCTCGAGATTCAAAGTCACTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-1897s1c1
Sequence:CCGGCCTGGTTAACATGGACAACAACTCGAGTTGTTGTCCATGTTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-256s1c1
Sequence:CCGGCCAGAAGTTTCCCTACAGTAACTCGAGTTACTGTAGGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-388s1c1
Sequence:CCGGCGACTACTATATGGGTCCCAACTCGAGTTGGGACCCATATAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013756
GRHL3 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013756.1-2498s1c1
Sequence:CCGGGCACAAGATGTAAGTCACCATCTCGAGATGGTGACTTACATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-873s1c1
Sequence:CCGGGCCTCAAGAGTGACTTTGAATCTCGAGATTCAAAGTCACTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-1897s1c1
Sequence:CCGGCCTGGTTAACATGGACAACAACTCGAGTTGTTGTCCATGTTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-256s1c1
Sequence:CCGGCCAGAAGTTTCCCTACAGTAACTCGAGTTACTGTAGGGAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013756.1-388s1c1
Sequence:CCGGCGACTACTATATGGGTCCCAACTCGAGTTGGGACCCATATAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks