EMAIL THIS PAGE TO A FRIEND

GRHPR

glyoxylate reductase/hydroxypyruvate reductase

53 Gene Product Result for
Synonyms: GLXR GLYD PH2
UniProtKB ID: Q9UBQ7, Q5T945, Q9H3E9, Q9UKX1
Gene ID:
Human(9380) Summary: This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]
Mouse(76238) glyoxylate reductase/hydroxypyruvate reductase
Rat(680021) glyoxylate reductase/hydroxypyruvate reductase
domestic guinea pig(100713105) glyoxylate reductase/hydroxypyruvate reductase
naked mole-rat(101701531) glyoxylate reductase/hydroxypyruvate reductase
sheep(101108191) glyoxylate reductase/hydroxypyruvate reductase
chicken(426806) glyoxylate reductase/hydroxypyruvate reductase
cow(504764) glyoxylate reductase/hydroxypyruvate reductase
domestic cat(100302391) glyoxylate reductase/hydroxypyruvate reductase
dog(612041) glyoxylate reductase/hydroxypyruvate reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012203 Rosetta Predictions human pricing
NM_001113754 Rosetta Predictions rat pricing
NM_080289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086660 predicted 710
2 SASI_Hs01_00086661 predicted 532
3 SASI_Hs01_00086663 predicted 1007
4 SASI_Hs01_00086664 predicted 560
5 SASI_Hs01_00086665 predicted 934
6 SASI_Hs01_00086666 predicted 611
7 SASI_Hs01_00086667 predicted 353
8 SASI_Hs01_00086669 predicted 1013
9 SASI_Hs02_00343855 predicted 286
10 SASI_Hs02_00343856 predicted 1011
11 SASI_Hs01_00086662 predicted 858
12 SASI_Hs01_00086668 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252003 predicted 579
2 SASI_Rn02_00252004 predicted 1020
3 SASI_Rn02_00252005 predicted 263
4 SASI_Rn02_00252006 predicted 540
5 SASI_Rn02_00252007 predicted 1029
6 SASI_Rn02_00252008 predicted 982
7 SASI_Rn02_00252009 predicted 685
8 SASI_Rn02_00252010 predicted 1039
9 SASI_Rn02_00252011 predicted 825
10 SASI_Rn02_00252012 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338082 predicted 745
2 SASI_Mm01_00181940 predicted 677
3 SASI_Mm01_00181941 predicted 762
4 SASI_Mm01_00181942 predicted 248
5 SASI_Mm01_00181944 predicted 794
6 SASI_Mm01_00181945 predicted 942
7 SASI_Mm01_00181946 predicted 711
8 SASI_Mm01_00181947 predicted 557
9 SASI_Mm02_00338083 predicted 955
10 SASI_Mm01_00181948 predicted 804
11 SASI_Mm01_00181939 predicted 614
12 SASI_Mm01_00181943 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012203
VALIDATED
GRHPR MISSION shRNA Bacterial Glycerol Stock
glyoxylate reductase/hydroxypyruvate reductase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012203.1-566s1c1
Sequence:CCGGCGGTGTCCAGAGATTTCTGTACTCGAGTACAGAAATCTCTGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-953s1c1
Sequence:CCGGCATGTCCTTGTTGGCAGCTAACTCGAGTTAGCTGCCAACAAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-685s1c1
Sequence:CCGGCCTGCTCCTTAACACCTGCAACTCGAGTTGCAGGTGTTAAGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-891s1c1
Sequence:CCGGACCCTGAAGAACTGTGTGATTCTCGAGAATCACACAGTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-1007s1c1
Sequence:CCGGGCCTAGTGAACTCAAGCTGTACTCGAGTACAGCTTGAGTTCACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-561s21c1
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-858s21c1
Sequence:CCGGCCAGAACCACTGCCTACAAACCTCGAGGTTTGTAGGCAGTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-1056s21c1
Sequence:CCGGAGCAAACCGTGCCCTGGTATTCTCGAGAATACCAGGGCACGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-811s21c1
Sequence:CCGGCCTTGGCCAGTGGTAAGATTGCTCGAGCAATCTTACCACTGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-299s21c1
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012203
VALIDATED
GRHPR MISSION shRNA shRNA Plasmid DNA
glyoxylate reductase/hydroxypyruvate reductase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012203.1-566s1c1
Sequence:CCGGCGGTGTCCAGAGATTTCTGTACTCGAGTACAGAAATCTCTGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-953s1c1
Sequence:CCGGCATGTCCTTGTTGGCAGCTAACTCGAGTTAGCTGCCAACAAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-685s1c1
Sequence:CCGGCCTGCTCCTTAACACCTGCAACTCGAGTTGCAGGTGTTAAGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-891s1c1
Sequence:CCGGACCCTGAAGAACTGTGTGATTCTCGAGAATCACACAGTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-1007s1c1
Sequence:CCGGGCCTAGTGAACTCAAGCTGTACTCGAGTACAGCTTGAGTTCACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-561s21c1
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-858s21c1
Sequence:CCGGCCAGAACCACTGCCTACAAACCTCGAGGTTTGTAGGCAGTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-1056s21c1
Sequence:CCGGAGCAAACCGTGCCCTGGTATTCTCGAGAATACCAGGGCACGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-811s21c1
Sequence:CCGGCCTTGGCCAGTGGTAAGATTGCTCGAGCAATCTTACCACTGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-299s21c1
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012203
VALIDATED
GRHPR MISSION shRNA Lentiviral Transduction Particles
glyoxylate reductase/hydroxypyruvate reductase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012203.1-566s1c1
Sequence:CCGGCGGTGTCCAGAGATTTCTGTACTCGAGTACAGAAATCTCTGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-953s1c1
Sequence:CCGGCATGTCCTTGTTGGCAGCTAACTCGAGTTAGCTGCCAACAAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-685s1c1
Sequence:CCGGCCTGCTCCTTAACACCTGCAACTCGAGTTGCAGGTGTTAAGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-891s1c1
Sequence:CCGGACCCTGAAGAACTGTGTGATTCTCGAGAATCACACAGTTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012203.1-1007s1c1
Sequence:CCGGGCCTAGTGAACTCAAGCTGTACTCGAGTACAGCTTGAGTTCACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-561s21c1
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-858s21c1
Sequence:CCGGCCAGAACCACTGCCTACAAACCTCGAGGTTTGTAGGCAGTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-1056s21c1
Sequence:CCGGAGCAAACCGTGCCCTGGTATTCTCGAGAATACCAGGGCACGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-811s21c1
Sequence:CCGGCCTTGGCCAGTGGTAAGATTGCTCGAGCAATCTTACCACTGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012203.1-299s21c1
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080289
VALIDATED
GRHPR MISSION shRNA Bacterial Glycerol Stock
glyoxylate reductase/hydroxypyruvate reductase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-618s1c1
Sequence:CCGGGCCGAGTTTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGAAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-299s1c1
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-1007s1c1
Sequence:CCGGGCCCAGCGAACTCAAGCTGTACTCGAGTACAGCTTGAGTTCGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-228s1c1
Sequence:CCGGGTGGACAAGAAACTTCTGGATCTCGAGATCCAGAAGTTTCTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-561s1c1
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-561s21c4
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-618s21c2
Sequence:CCGGGCCGAGTTTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGAAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-228s21c2
Sequence:CCGGGTGGACAAGAAACTTCTGGATCTCGAGATCCAGAAGTTTCTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-299s21c2
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080289
VALIDATED
GRHPR MISSION shRNA shRNA Plasmid DNA
glyoxylate reductase/hydroxypyruvate reductase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-618s1c1
Sequence:CCGGGCCGAGTTTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGAAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-299s1c1
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-1007s1c1
Sequence:CCGGGCCCAGCGAACTCAAGCTGTACTCGAGTACAGCTTGAGTTCGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-228s1c1
Sequence:CCGGGTGGACAAGAAACTTCTGGATCTCGAGATCCAGAAGTTTCTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-561s1c1
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-561s21c4
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-618s21c2
Sequence:CCGGGCCGAGTTTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGAAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-228s21c2
Sequence:CCGGGTGGACAAGAAACTTCTGGATCTCGAGATCCAGAAGTTTCTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-299s21c2
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080289
VALIDATED
GRHPR MISSION shRNA Lentiviral Transduction Particles
glyoxylate reductase/hydroxypyruvate reductase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-618s1c1
Sequence:CCGGGCCGAGTTTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGAAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-299s1c1
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-1007s1c1
Sequence:CCGGGCCCAGCGAACTCAAGCTGTACTCGAGTACAGCTTGAGTTCGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-228s1c1
Sequence:CCGGGTGGACAAGAAACTTCTGGATCTCGAGATCCAGAAGTTTCTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080289.1-561s1c1
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-561s21c4
Sequence:CCGGCCATTCGGTGTCCAGAGATTTCTCGAGAAATCTCTGGACACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-618s21c2
Sequence:CCGGGCCGAGTTTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGAAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-228s21c2
Sequence:CCGGGTGGACAAGAAACTTCTGGATCTCGAGATCCAGAAGTTTCTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080289.1-299s21c2
Sequence:CCGGCCACTTGGCTTTGGATGAAATCTCGAGATTTCATCCAAAGCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks