EMAIL THIS PAGE TO A FRIEND

GRIA1

glutamate receptor, ionotropic, AMPA 1

176 Gene Product Result for
Synonyms: GLUH1 GLUR1 GLURA GluA1 HBGR1
Gene ID:
Human(2890) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14799) glutamate receptor, ionotropic, AMPA1 (alpha 1)
Rat(50592) glutamate receptor, ionotropic, AMPA 1
sheep(443271) glutamate receptor, ionotropic, AMPA 1
Domestic Rabbit(100348217) glutamate receptor, ionotropic, AMPA 1
domestic guinea pig(100727046) glutamate receptor, ionotropic, AMPA 1
naked mole-rat(101724828) glutamate receptor, ionotropic, AMPA 1
chicken(414893) glutamate receptor, ionotropic, AMPA 1
cow(529618) glutamate receptor, ionotropic, AMPA 1
Horse(100060020) glutamate receptor, ionotropic, AMPA 1
domestic cat(101097621) glutamate receptor, ionotropic, AMPA 1
dog(489168) glutamate receptor, ionotropic, AMPA 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501293 Anti-GLUR1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501294 Anti-GLUR1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300507 Anti-GRIA1 (Ab-849) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300508 Anti-GRIA1 (Ab-863) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence pricing
SAB2501671 Anti-GRIA1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, rat, mouse, bovine
ELISA, western blot pricing
HPA035202 Anti-GRIA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106412 Anti-GRIA1 antibody produced in rabbit affinity isolated antibody horse, mouse, human, guinea pig, rabbit
ELISA, western blot pricing
A4352 Anti-phospho-AMPA Receptor, GluR1 Subunit (pSer831) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
A4477 Anti-phospho-AMPA Receptor, GluR1 Subunit (pSer845) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, rat
dot blot, western blot pricing
SAB4504416 Anti-phospho-GluR1 (pSer849) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4504417 Anti-phospho-GluR1 (pSer863) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300207 Anti-phospho-GRIA1 (pSer849) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB5201095 Monoclonal Anti-Glua1/Glur1 - Alkaline Phosphatase antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201096 Monoclonal Anti-Glua1/Glur1 - Apc antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201087 Monoclonal Anti-Glua1/Glur1 - Atto 390 antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201088 Monoclonal Anti-Glua1/Glur1 - Atto 488 antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201089 Monoclonal Anti-Glua1/Glur1 - Atto 565 antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201090 Monoclonal Anti-Glua1/Glur1 - Atto 594 antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201091 Monoclonal Anti-Glua1/Glur1 - Atto 633 antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201092 Monoclonal Anti-Glua1/Glur1 - Atto 655 antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201093 Monoclonal Anti-Glua1/Glur1 - Atto 680 antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201094 Monoclonal Anti-Glua1/Glur1 - Atto 700 antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201097 Monoclonal Anti-Glua1/Glur1 - Biotin antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201098 Monoclonal Anti-Glua1/Glur1 - Fitc antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201099 Monoclonal Anti-Glua1/Glur1 - Hrp antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201100 Monoclonal Anti-Glua1/Glur1 - Pe/Atto 594 antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201101 Monoclonal Anti-Glua1/Glur1 - Percp antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201102 Monoclonal Anti-Glua1/Glur1 - Rpe antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201103 Monoclonal Anti-Glua1/Glur1 - Streptavidin antibody produced in mouse clone S355-1, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201086 Monoclonal Anti-Glua1/Glur1 antibody produced in mouse clone S355-1, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
WH0002890M1 Monoclonal Anti-GRIA1 antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C271 CX546 ≥98% (HPLC), solid human pricing
D9035 Diazoxide human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C239 CNQX disodium salt hydrate ≥98% (HPLC), solid human pricing
G119 GYKI 52466 hydrochloride solid human pricing
N183 NBQX disodium salt hydrate ≥98% (HPLC), lyophilized solid human pricing
A0326 (S)-AMPA ≥98% human, mouse, rat pricing
D138 5,7-Dichlorokynurenic acid monohydrate solid, ≥98% (HPLC) human, mouse, rat pricing
D0540 DNQX ≥98% (TLC) human, mouse, rat pricing
K0250 Kainic acid monohydrate ≥99% (TLC) human, mouse, rat pricing
G137 (2S,4R)-4-Methylglutamic acid solid human, rat pricing
324817 (Aminomethyl)phosphonic acid 99% human, rat pricing
MET12133A (Aminomethyl)phosphonic acid analytical standard human, rat pricing
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing
A7845 ATPO solid human, rat pricing
G120 GYKI 52895 solid human, rat pricing
K3375 Kynurenic acid ≥98% human, rat pricing
G5667 L-Glutamic acid PharmaGrade, Ajinomoto, EP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
W328502 L-Glutamic acid 99%, FCC human, rat pricing
G8415 L-Glutamic acid from non-animal source, meets EP testing specifications, suitable for cell culture, 98.5-100.5% human, rat pricing
49449 L-Glutamic acid BioUltra, ≥99.5% (NT) human, rat pricing
G1251 L-Glutamic acid ReagentPlus®, ≥99% (HPLC) human, rat pricing
09581 L-Glutamic acid tested according to Ph.Eur. human, rat pricing
M3262 N-Methyl-D-aspartic acid ≥98% (TLC), solid human, rat pricing
P5295 Piracetam human, rat pricing
144789 2,3-Dihydroxyquinoxaline 98% rat pricing
P63204 2,3-Pyridinedicarboxylic acid 99% rat pricing
657239 6-Nitro-2,3-dihydroxyquinoxaline 96% rat pricing
C127 CNQX ≥98% (HPLC), solid rat pricing
P7575 L-trans-Pyrrolidine-2,4-dicarboxylic acid ≥98% rat pricing
M3387 N-Methyl-L-aspartic acid rat pricing
33895 Piracetam VETRANAL, analytical standard rat pricing
Q2128 Quisqualic acid powder rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C9847 Cyclothiazide human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing
A263 ATPA solid human, rat pricing
A6816 (±)-AMPA solid rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000827 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151461 MISSION® esiRNA esiRNA human GRIA1 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
ABN241 Anti-GluR1 Antibody 100 µg, Anti-GluR1 Antibody is a highly specific rabbit polyclonal antibody, that targets GluR1 & has been tested in western blotting & IHC (Paraffin). pricing
04-855 Anti-GluR1 Antibody, clone C3T, rabbit monoclonal 100 µL, Anti-GluR1 Antibody, clone C3T detects level of GluR1 & has been published & validated for use in IH, IP & WB. pricing
MAB2263 Anti-GluR1-NT (NT) Antibody, clone RH95 100 µg, Anti-GluR1-NT (N-terminus) Antibody, clone RH95 is an antibody against GluR1-NT (N-terminus) for use in WB, IP, IC, ELISA. pricing
AB1504 Anti-Glutamate receptor 1 Antibody 200 µL, This Anti-Glutamate receptor 1 Antibody is validated for use in WB, IH(P), IP for the detection of Glutamate receptor 1. pricing
AB5847 Anti-Glutamate Receptor 1 Antibody, phosphoSer 831 150 µL, Detect Glutamate Receptor 1 using this Anti-Glutamate Receptor 1 Antibody, phosphoSer 831 validated for use in WB. pricing
AB5847-25UL Anti-Glutamate Receptor 1 Antibody, phosphoSer 831 25 µL, Anti-Glutamate Receptor 1 Antibody, phosphoSer 831 detects level of Glutamate Receptor 1 & has been published & validated for use in WB. pricing
AB5849 Anti-Glutamate Receptor 1 Antibody, phosphoSer 845 150 µL, Anti-Glutamate Receptor 1 Antibody, phosphoSer 845 is an antibody against Glutamate Receptor 1 for use in WB. pricing
AB5849-25UL Anti-Glutamate Receptor 1 Antibody, phosphoSer 845 25 µL, This Anti-Glutamate Receptor 1 Antibody, phosphoSer 845 is validated for use in WB for the detection of Glutamate Receptor 1. pricing
MABN832 Anti-pan-AMPA receptor (GluR1-4), clone 2D8 Antibody 100 µg, Anti-pan-AMPA receptor (GluR1-4), clone 2D8 Antibody is an antibody against AMPA receptor for use in Western Blotting, Immunohistochemistry and Immunocytochemistry, Enzyme Immunoassay (ELISA), Electron Microscopy and Immunofluorescence. pricing
04-823 Anti-phospho-GluR1 (Ser831) Antibody, clone N453, rabbit monoclonal 100 µL, Anti-phospho-GluR1 (Ser831) Antibody, clone N453 detects level of phospho-GluR1 (Ser831) & has been published & validated for use in WB. pricing
AB2292 Anti-phospho GluR1 (Thr840) Antibody 100 µg, Detect phospho GluR1 (Thr840) using this Anti-phospho GluR1 (Thr840) Antibody validated for use in WB. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000827 Rosetta Predictions human pricing
NM_001114183 Rosetta Predictions human pricing
NM_031608 Rosetta Predictions rat pricing
NM_001113325 Rosetta Predictions mouse pricing
NM_008165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108133 predicted 992
2 SASI_Hs01_00108135 predicted 1440
3 SASI_Hs02_00303313 predicted 2056
4 SASI_Hs01_00108136 predicted 842
5 SASI_Hs01_00108137 predicted 560
6 SASI_Hs01_00108138 predicted 1957
7 SASI_Hs01_00108140 predicted 2101
8 SASI_Hs02_00303314 predicted 546
9 SASI_Hs02_00303315 predicted 1060
10 SASI_Hs01_00108141 predicted 1409
11 SASI_Hs01_00108134 predicted 2628
12 SASI_Hs01_00108139 predicted 2611
13 SASI_Hs01_00108142 predicted 2638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326464 predicted 988
2 SASI_Hs02_00326465 predicted 1447
3 SASI_Hs02_00326466 predicted 2054
4 SASI_Hs02_00326467 predicted 848
5 SASI_Hs02_00326468 predicted 564
6 SASI_Hs02_00326469 predicted 1953
7 SASI_Hs02_00326470 predicted 2108
8 SASI_Hs02_00326471 predicted 543
9 SASI_Hs02_00326472 predicted 1060
10 SASI_Hs02_00326473 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092219 predicted 1873
2 SASI_Rn01_00092220 predicted 440
3 SASI_Rn01_00092221 predicted 1562
4 SASI_Rn02_00264898 predicted 903
5 SASI_Rn02_00264899 predicted 1935
6 SASI_Rn01_00092222 predicted 1308
7 SASI_Rn01_00092223 predicted 530
8 SASI_Rn01_00092224 predicted 1922
9 SASI_Rn01_00092225 predicted 1280
10 SASI_Rn02_00264900 predicted 600
11 SASI_Rn01_00092217 predicted 1425
12 SASI_Rn01_00092218 predicted 1448
13 SASI_Rn01_00092226 predicted 2667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307343 predicted 1864
2 SASI_Mm02_00307344 predicted 1564
3 SASI_Mm02_00307345 predicted 1045
4 SASI_Mm02_00307346 predicted 1276
5 SASI_Mm02_00307347 predicted 2081
6 SASI_Mm02_00307348 predicted 753
7 SASI_Mm02_00307349 predicted 1689
8 SASI_Mm02_00307350 predicted 1422
9 SASI_Mm02_00307351 predicted 1036
10 SASI_Mm02_00307352 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030867 predicted 1858
2 SASI_Mm01_00030868 predicted 1559
3 SASI_Mm01_00030869 predicted 1045
4 SASI_Mm01_00030870 predicted 1274
5 SASI_Mm01_00030871 predicted 2079
6 SASI_Mm01_00030872 predicted 748
7 SASI_Mm01_00030873 predicted 1692
8 SASI_Mm01_00030874 predicted 1423
9 SASI_Mm02_00313277 predicted 1038
10 SASI_Mm01_00030875 predicted 2054
11 SASI_Mm01_00030876 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008165
VALIDATED
GRIA1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-733s21c1
Sequence:CCGGGGAAGCTCTCATTAGCATTATCTCGAGATAATGCTAATGAGAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-3340s21c1
Sequence:CCGGCAAGGAAGTCTAACGTCTATACTCGAGTATAGACGTTAGACTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2072s21c1
Sequence:CCGGACAACCAGTGACCAGTCAAATCTCGAGATTTGACTGGTCACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2300s21c1
Sequence:CCGGCTGGCAAAGCAGACGGAAATTCTCGAGAATTTCCGTCTGCTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2817s21c1
Sequence:CCGGTAATCGAGTTCTGCTACAAATCTCGAGATTTGTAGCAGAACTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008165.2-3444s1c1
Sequence:CCGGCCCAGAAAGAATACTACCTAACTCGAGTTAGGTAGTATTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008165.2-272s1c1
Sequence:CCGGGCGACAGCTTTGAGATGACTTCTCGAGAAGTCATCTCAAAGCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-1751s1c1
Sequence:CCGGGCCGTTTCAGTCCTTATGAATCTCGAGATTCATAAGGACTGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-1287s1c1
Sequence:CCGGCGTCCAGAATAGAACCTACATCTCGAGATGTAGGTTCTATTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-2340s1c1
Sequence:CCGGCGCCCTGAGAAATCCAGTAAACTCGAGTTTACTGGATTTCTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008165
VALIDATED
GRIA1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-733s21c1
Sequence:CCGGGGAAGCTCTCATTAGCATTATCTCGAGATAATGCTAATGAGAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-3340s21c1
Sequence:CCGGCAAGGAAGTCTAACGTCTATACTCGAGTATAGACGTTAGACTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2072s21c1
Sequence:CCGGACAACCAGTGACCAGTCAAATCTCGAGATTTGACTGGTCACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2300s21c1
Sequence:CCGGCTGGCAAAGCAGACGGAAATTCTCGAGAATTTCCGTCTGCTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2817s21c1
Sequence:CCGGTAATCGAGTTCTGCTACAAATCTCGAGATTTGTAGCAGAACTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008165.2-3444s1c1
Sequence:CCGGCCCAGAAAGAATACTACCTAACTCGAGTTAGGTAGTATTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008165.2-272s1c1
Sequence:CCGGGCGACAGCTTTGAGATGACTTCTCGAGAAGTCATCTCAAAGCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-1751s1c1
Sequence:CCGGGCCGTTTCAGTCCTTATGAATCTCGAGATTCATAAGGACTGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-1287s1c1
Sequence:CCGGCGTCCAGAATAGAACCTACATCTCGAGATGTAGGTTCTATTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-2340s1c1
Sequence:CCGGCGCCCTGAGAAATCCAGTAAACTCGAGTTTACTGGATTTCTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008165
VALIDATED
GRIA1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-733s21c1
Sequence:CCGGGGAAGCTCTCATTAGCATTATCTCGAGATAATGCTAATGAGAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-3340s21c1
Sequence:CCGGCAAGGAAGTCTAACGTCTATACTCGAGTATAGACGTTAGACTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2072s21c1
Sequence:CCGGACAACCAGTGACCAGTCAAATCTCGAGATTTGACTGGTCACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2300s21c1
Sequence:CCGGCTGGCAAAGCAGACGGAAATTCTCGAGAATTTCCGTCTGCTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008165.3-2817s21c1
Sequence:CCGGTAATCGAGTTCTGCTACAAATCTCGAGATTTGTAGCAGAACTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008165.2-3444s1c1
Sequence:CCGGCCCAGAAAGAATACTACCTAACTCGAGTTAGGTAGTATTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008165.2-272s1c1
Sequence:CCGGGCGACAGCTTTGAGATGACTTCTCGAGAAGTCATCTCAAAGCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-1751s1c1
Sequence:CCGGGCCGTTTCAGTCCTTATGAATCTCGAGATTCATAAGGACTGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-1287s1c1
Sequence:CCGGCGTCCAGAATAGAACCTACATCTCGAGATGTAGGTTCTATTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008165.2-2340s1c1
Sequence:CCGGCGCCCTGAGAAATCCAGTAAACTCGAGTTTACTGGATTTCTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000827
GRIA1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000061638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-1419s1c1
Sequence:CCGGGCCAATCAGTTTGAGGGCAATCTCGAGATTGCCCTCAAACTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-314s1c1
Sequence:CCGGCCAGATTGATATTGTGAACATCTCGAGATGTTCACAATATCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-2418s1c1
Sequence:CCGGCCAGTAAACCTGGCAGTGTTACTCGAGTAACACTGCCAGGTTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-1827s1c1
Sequence:CCGGCCCTATGAATGGCACAGTGAACTCGAGTTCACTGTGCCATTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000827
GRIA1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000061638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-1419s1c1
Sequence:CCGGGCCAATCAGTTTGAGGGCAATCTCGAGATTGCCCTCAAACTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-314s1c1
Sequence:CCGGCCAGATTGATATTGTGAACATCTCGAGATGTTCACAATATCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-2418s1c1
Sequence:CCGGCCAGTAAACCTGGCAGTGTTACTCGAGTAACACTGCCAGGTTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-1827s1c1
Sequence:CCGGCCCTATGAATGGCACAGTGAACTCGAGTTCACTGTGCCATTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000827
GRIA1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000061638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-1419s1c1
Sequence:CCGGGCCAATCAGTTTGAGGGCAATCTCGAGATTGCCCTCAAACTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-314s1c1
Sequence:CCGGCCAGATTGATATTGTGAACATCTCGAGATGTTCACAATATCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-2418s1c1
Sequence:CCGGCCAGTAAACCTGGCAGTGTTACTCGAGTAACACTGCCAGGTTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000827.2-1827s1c1
Sequence:CCGGCCCTATGAATGGCACAGTGAACTCGAGTTCACTGTGCCATTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks