EMAIL THIS PAGE TO A FRIEND

GRIA2

glutamate receptor, ionotropic, AMPA 2

249 Gene Product Result for
Synonyms: GLUR2 GLURB GluA2 GluR-K2 HBGR2
UniProtKB ID: P42262, Q96FP6
Gene ID:
Human(2891) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, GRIA1-4. The subunit encoded by this gene (GRIA2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Human and animal studies suggest that pre-mRNA editing is essential for brain function, and defective GRIA2 RNA editing at the Q/R site may be relevant to amyotrophic lateral sclerosis (ALS) etiology. Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(14800) glutamate receptor, ionotropic, AMPA2 (alpha 2)
Rat(29627) glutamate receptor, ionotropic, AMPA 2
chicken(414894) glutamate receptor, ionotropic, AMPA 2
domestic cat(101088234) glutamate receptor, ionotropic, AMPA 2
cow(614283) glutamate receptor, ionotropic, AMPA 2
Horse(100069331) glutamate receptor, ionotropic, AMPA 2
dog(482667) glutamate receptor, ionotropic, AMPA 2
domestic guinea pig(100379153) glutamate receptor, ionotropic, AMPA2 (alpha 2)
naked mole-rat(101708417) glutamate receptor, ionotropic, AMPA 2
sheep(443272) glutamate receptor, ionotropic, AMPA 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C271 CX546 ≥98% (HPLC), solid human pricing
P5295 Piracetam human, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
C9847 Cyclothiazide human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0131 AQUA Peptide ADIAIAPLTITLV[R] chicken, cow, dog, human, mouse, rat pricing
AQ0082 AQUA Peptide DKVNDIVDQVITIG[K] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB10529 Anti-GluR-2 Antibody, CT 100 µL, Anti-GluR-2 Antibody, C-terminus detects level of GluR-2 & has been published & validated for use in WB. pricing
AB1768-I Anti-GluR2 Antibody 25 µg, This GluR2 antibody is validated for use in WB & IHC for the detection of the GluR2 protein. pricing
MABN1189 Anti-GluR2 Antibody, clone 14C12.2 100 μg, Anti-GluR2, clone 14C12.2, Cat. No. MABN1189, is a highly specific mouse monoclonal antibody, that targets Glutamate Receptor 2 and has been tested in Western Blotting and Immunohistochemistry (Paraffin). pricing
MAB397A4 Anti-GluR2 Antibody, clone 6C4, Alexa Fluor® 488 Conjugate 100 µL, This Anti-GluR2 Antibody, clone 6C4, Alexa Fluor 488 Conjugate is validated for use in IH, IC for the detection of GluR2. pricing
MABN71 Anti-GluR2 Antibody, clone L21/32 100 µg, Detect GluR2 using this Anti-GluR2 Antibody, clone L21/32 validated for use in WB, IH. pricing
MABN103 Anti-GLUR2 pS880 (Clone 022.19.5) Antibody 100 µg, This Anti-GLUR2 pS880 (Clone 022.19.5) Antibody is validated for use in WB for the detection of GLUR2 pS880 (Clone 022.19.5). pricing
AB1506 Anti-Glutamate Receptor 2 & 3 Antibody 50 µg, This Anti-Glutamate Receptor 2 & 3 Antibody is validated for use in IH(P), IC, IH, IP, WB for the detection of Glutamate Receptor 2 & 3. pricing
MAB397 Anti-Glutamate Receptor 2 Antibody, extracellular, clone 6C4 100 µg, Anti-Glutamate Receptor 2 Antibody, extracellular, clone 6C4 detects level of Glutamate Receptor 2 & has been published & validated for use in ELISA, IC, IH, IP, RIA & WB with more than 50 product citations. pricing
07-294 Anti-phospho-GluR2 (Ser880) Antibody 100 µL, This Anti-phospho-GluR2 (Ser880) Antibody is validated for use in IC, EA, WB for the detection of phospho-GluR2 (Ser880). pricing
AG305 Glutamate Receptor 2 & 3, control peptide for AB1506 100 µg pricing
FCMAB290F Milli-Mark™ Anti-GluR2-FITC Antibody, clone 6C4 100 tests, This Milli-Mark Anti-GluR2-FITC Antibody, clone 6C4 is validated for use in FC for the detection of GluR2. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000826 Rosetta Predictions human pricing
NM_001083619 Rosetta Predictions human pricing
NM_001083620 Rosetta Predictions human pricing
NM_001083811 Rosetta Predictions rat pricing
NM_017261 Rosetta Predictions rat pricing
NM_001039195 Rosetta Predictions mouse pricing
NM_001083806 Rosetta Predictions mouse pricing
NM_013540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035395 predicted 884
2 SASI_Hs01_00035396 predicted 1495
3 SASI_Hs01_00035397 predicted 2209
4 SASI_Hs01_00035398 predicted 1777
5 SASI_Hs01_00035399 predicted 2219
6 SASI_Hs01_00035401 predicted 1091
7 SASI_Hs01_00035402 predicted 894
8 SASI_Hs01_00035404 predicted 1348
9 SASI_Hs02_00303311 predicted 3070
10 SASI_Hs02_00303312 predicted 1201
11 SASI_Hs01_00035400 predicted 1591
12 SASI_Hs01_00035403 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317161 predicted 878
2 SASI_Hs02_00317162 predicted 1498
3 SASI_Hs02_00317163 predicted 2210
4 SASI_Hs02_00317164 predicted 1775
5 SASI_Hs02_00317165 predicted 2217
6 SASI_Hs02_00317166 predicted 1096
7 SASI_Hs02_00317167 predicted 894
8 SASI_Hs02_00317168 predicted 1357
9 SASI_Hs02_00317169 predicted 3068
10 SASI_Hs02_00317170 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317171 predicted 393
2 SASI_Hs02_00317172 predicted 1008
3 SASI_Hs02_00317173 predicted 1718
4 SASI_Hs02_00317174 predicted 1287
5 SASI_Hs02_00317175 predicted 1726
6 SASI_Hs02_00317176 predicted 601
7 SASI_Hs02_00317177 predicted 397
8 SASI_Hs02_00317178 predicted 868
9 SASI_Hs02_00317179 predicted 2581
10 SASI_Hs02_00317180 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208909 predicted 1320
2 SASI_Rn02_00208910 predicted 2182
3 SASI_Rn02_00208911 predicted 3154
4 SASI_Rn02_00208912 predicted 1683
5 SASI_Rn02_00208913 predicted 2191
6 SASI_Rn02_00208914 predicted 1747
7 SASI_Rn02_00208915 predicted 1523
8 SASI_Rn02_00208916 predicted 995
9 SASI_Rn02_00208917 predicted 1087
10 SASI_Rn02_00208918 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075510 predicted 1320
2 SASI_Rn01_00075511 predicted 2178
3 SASI_Rn01_00075514 predicted 3148
4 SASI_Rn01_00075515 predicted 1680
5 SASI_Rn01_00075516 predicted 2189
6 SASI_Rn01_00075518 predicted 1751
7 SASI_Rn02_00261656 predicted 1527
8 SASI_Rn02_00261657 predicted 996
9 SASI_Rn01_00075519 predicted 1090
10 SASI_Rn02_00261658 predicted 1182
11 SASI_Rn01_00075512 predicted 552
12 SASI_Rn01_00075513 predicted 864
13 SASI_Rn01_00075517 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082489 predicted 2153
2 SASI_Mm02_00289937 predicted 1719
3 SASI_Mm01_00082490 predicted 1656
4 SASI_Mm01_00082491 predicted 1327
5 SASI_Mm01_00082492 predicted 1506
6 SASI_Mm01_00082493 predicted 2163
7 SASI_Mm01_00082494 predicted 1017
8 SASI_Mm01_00082495 predicted 1072
9 SASI_Mm01_00082497 predicted 1749
10 SASI_Mm02_00289938 predicted 1619
11 SASI_Mm01_00082496 predicted 848
12 SASI_Mm01_00082498 predicted 1767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299751 predicted 2154
2 SASI_Mm02_00299752 predicted 1727
3 SASI_Mm02_00299753 predicted 1662
4 SASI_Mm02_00299754 predicted 1324
5 SASI_Mm02_00299755 predicted 1507
6 SASI_Mm02_00299756 predicted 2162
7 SASI_Mm02_00299757 predicted 1022
8 SASI_Mm02_00299758 predicted 1074
9 SASI_Mm02_00299759 predicted 1756
10 SASI_Mm02_00299760 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091464 predicted 2158
2 SASI_Mm02_00322243 predicted 1722
3 SASI_Mm01_00091465 predicted 1660
4 SASI_Mm01_00091466 predicted 1326
5 SASI_Mm01_00091467 predicted 1508
6 SASI_Mm01_00091468 predicted 2166
7 SASI_Mm01_00091469 predicted 1018
8 SASI_Mm01_00091470 predicted 1079
9 SASI_Mm01_00091472 predicted 1748
10 SASI_Mm02_00322244 predicted 1619
11 SASI_Mm01_00091471 predicted 847
12 SASI_Mm01_00091473 predicted 1772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000826
GRIA2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-823s1c1
Sequence:CCGGCCAGGTTATTACCATTGGAAACTCGAGTTTCCAATGGTAATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-1067s1c1
Sequence:CCGGGCCGTTCAAGTGATGACTGAACTCGAGTTCAGTCATCACTTGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-689s1c1
Sequence:CCGGGCTATCAATGTGGGAAACATTCTCGAGAATGTTTCCCACATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-1519s1c1
Sequence:CCGGCGCCAAACATTGTGGGTTCAACTCGAGTTGAACCCACAATGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-2455s1c1
Sequence:CCGGCCCAGTAAATCTTGCAGTATTCTCGAGAATACTGCAAGATTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1945s21c1
Sequence:CCGGGCAATTGCTCCATTAACTATTCTCGAGAATAGTTAATGGAGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-2276s21c1
Sequence:CCGGTGCGGCAAGGATGCGATATTTCTCGAGAAATATCGCATCCTTGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1184s21c1
Sequence:CCGGTTACTGATGGAGACCTATTAACTCGAGTTAATAGGTCTCCATCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1255s21c1
Sequence:CCGGGATGATTCGTTGGTATCTAAACTCGAGTTTAGATACCAACGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000826
GRIA2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-823s1c1
Sequence:CCGGCCAGGTTATTACCATTGGAAACTCGAGTTTCCAATGGTAATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-1067s1c1
Sequence:CCGGGCCGTTCAAGTGATGACTGAACTCGAGTTCAGTCATCACTTGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-689s1c1
Sequence:CCGGGCTATCAATGTGGGAAACATTCTCGAGAATGTTTCCCACATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-1519s1c1
Sequence:CCGGCGCCAAACATTGTGGGTTCAACTCGAGTTGAACCCACAATGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-2455s1c1
Sequence:CCGGCCCAGTAAATCTTGCAGTATTCTCGAGAATACTGCAAGATTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1945s21c1
Sequence:CCGGGCAATTGCTCCATTAACTATTCTCGAGAATAGTTAATGGAGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-2276s21c1
Sequence:CCGGTGCGGCAAGGATGCGATATTTCTCGAGAAATATCGCATCCTTGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1184s21c1
Sequence:CCGGTTACTGATGGAGACCTATTAACTCGAGTTAATAGGTCTCCATCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1255s21c1
Sequence:CCGGGATGATTCGTTGGTATCTAAACTCGAGTTTAGATACCAACGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000826
GRIA2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-823s1c1
Sequence:CCGGCCAGGTTATTACCATTGGAAACTCGAGTTTCCAATGGTAATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-1067s1c1
Sequence:CCGGGCCGTTCAAGTGATGACTGAACTCGAGTTCAGTCATCACTTGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-689s1c1
Sequence:CCGGGCTATCAATGTGGGAAACATTCTCGAGAATGTTTCCCACATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-1519s1c1
Sequence:CCGGCGCCAAACATTGTGGGTTCAACTCGAGTTGAACCCACAATGTTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000826.1-2455s1c1
Sequence:CCGGCCCAGTAAATCTTGCAGTATTCTCGAGAATACTGCAAGATTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1945s21c1
Sequence:CCGGGCAATTGCTCCATTAACTATTCTCGAGAATAGTTAATGGAGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-2276s21c1
Sequence:CCGGTGCGGCAAGGATGCGATATTTCTCGAGAAATATCGCATCCTTGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1184s21c1
Sequence:CCGGTTACTGATGGAGACCTATTAACTCGAGTTAATAGGTCTCCATCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000826.3-1255s21c1
Sequence:CCGGGATGATTCGTTGGTATCTAAACTCGAGTTTAGATACCAACGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013540
GRIA2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013540.1-2927s1c1
Sequence:CCGGCGTGTTATGACTCCAGAATTTCTCGAGAAATTCTGGAGTCATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-1744s1c1
Sequence:CCGGGCCATTCATGAGCCTTGGAATCTCGAGATTCCAAGGCTCATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-631s1c1
Sequence:CCGGCCAATGGGATAAGTTCGCATACTCGAGTATGCGAACTTATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-2778s1c1
Sequence:CCGGCCTCGCAGAATTCCCAGAATTCTCGAGAATTCTGGGAATTCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-1563s1c1
Sequence:CCGGCCAAACATTGTGGATTCAAGTCTCGAGACTTGAATCCACAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013540
GRIA2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013540.1-2927s1c1
Sequence:CCGGCGTGTTATGACTCCAGAATTTCTCGAGAAATTCTGGAGTCATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-1744s1c1
Sequence:CCGGGCCATTCATGAGCCTTGGAATCTCGAGATTCCAAGGCTCATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-631s1c1
Sequence:CCGGCCAATGGGATAAGTTCGCATACTCGAGTATGCGAACTTATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-2778s1c1
Sequence:CCGGCCTCGCAGAATTCCCAGAATTCTCGAGAATTCTGGGAATTCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-1563s1c1
Sequence:CCGGCCAAACATTGTGGATTCAAGTCTCGAGACTTGAATCCACAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013540
GRIA2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013540.1-2927s1c1
Sequence:CCGGCGTGTTATGACTCCAGAATTTCTCGAGAAATTCTGGAGTCATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-1744s1c1
Sequence:CCGGGCCATTCATGAGCCTTGGAATCTCGAGATTCCAAGGCTCATGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-631s1c1
Sequence:CCGGCCAATGGGATAAGTTCGCATACTCGAGTATGCGAACTTATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-2778s1c1
Sequence:CCGGCCTCGCAGAATTCCCAGAATTCTCGAGAATTCTGGGAATTCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013540.1-1563s1c1
Sequence:CCGGCCAAACATTGTGGATTCAAGTCTCGAGACTTGAATCCACAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks