EMAIL THIS PAGE TO A FRIEND

GRIA3

glutamate receptor, ionotropic, AMPA 3

215 Gene Product Result for
Synonyms: GLUR-C GLUR-K3 GLUR3 GLURC GluA3 MRX94
Gene ID:
Human(2892) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing at this locus results in different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
Mouse(53623) glutamate receptor, ionotropic, AMPA3 (alpha 3)
Rat(29628) glutamate receptor, ionotropic, AMPA 3
chicken(396138) glutamate receptor, ionotropic, AMPA 3
cow(534626) glutamate receptor, ionotrophic, AMPA 3
Horse(100055136) glutamate receptor, ionotropic, AMPA 3
domestic cat(101089925) glutamate receptor, ionotropic, AMPA 3
dog(492110) glutamate receptor, ionotropic, AMPA 3
sheep(443273) glutamate receptor, ionotropic, AMPA 3
Domestic Rabbit(100341980) glutamate receptor, ionotropic, AMPA 3
naked mole-rat(101713289) glutamate receptor, ionotropic, AMPA 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C271 CX546 ≥98% (HPLC), solid human pricing
P5295 Piracetam human, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
C9847 Cyclothiazide human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
A6816 (±)-AMPA solid rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000828 Rosetta Predictions human pricing
NM_007325 Rosetta Predictions human pricing
NM_181894 Rosetta Predictions human pricing
NM_001112742 Rosetta Predictions rat pricing
NM_032990 Rosetta Predictions rat pricing
NM_016886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140627 predicted 1006
2 SASI_Hs01_00140628 predicted 1586
3 SASI_Hs01_00140629 predicted 1711
4 SASI_Hs02_00303316 predicted 1917
5 SASI_Hs01_00140630 predicted 1549
6 SASI_Hs01_00140631 predicted 1220
7 SASI_Hs01_00140632 predicted 1534
8 SASI_Hs01_00140633 predicted 1185
9 SASI_Hs01_00140634 predicted 1451
10 SASI_Hs01_00140635 predicted 844
11 SASI_Hs01_00140636 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117075 predicted 1007
2 SASI_Hs01_00117076 predicted 1582
3 SASI_Hs01_00117077 predicted 1702
4 SASI_Hs02_00343401 predicted 1917
5 SASI_Hs01_00117078 predicted 1546
6 SASI_Hs01_00117079 predicted 1224
7 SASI_Hs01_00117080 predicted 1534
8 SASI_Hs01_00117081 predicted 1189
9 SASI_Hs01_00117082 predicted 1451
10 SASI_Hs01_00117083 predicted 847
11 SASI_Hs01_00117084 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121196 predicted 386
2 SASI_Hs01_00121197 predicted 651
3 SASI_Hs01_00121198 predicted 705
4 SASI_Hs01_00121199 predicted 302
5 SASI_Hs01_00121200 predicted 688
6 SASI_Hs01_00121201 predicted 493
7 SASI_Hs01_00121202 predicted 656
8 SASI_Hs01_00121203 predicted 373
9 SASI_Hs01_00121204 predicted 390
10 SASI_Hs01_00121205 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251630 predicted 1246
2 SASI_Rn02_00251631 predicted 972
3 SASI_Rn02_00251632 predicted 235
4 SASI_Rn02_00251633 predicted 750
5 SASI_Rn02_00251634 predicted 934
6 SASI_Rn02_00251635 predicted 1138
7 SASI_Rn02_00251636 predicted 688
8 SASI_Rn02_00251637 predicted 1115
9 SASI_Rn02_00251638 predicted 1524
10 SASI_Rn02_00251639 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265496 predicted 1239
2 SASI_Rn01_00097126 predicted 970
3 SASI_Rn01_00097129 predicted 239
4 SASI_Rn01_00097132 predicted 752
5 SASI_Rn01_00097133 predicted 929
6 SASI_Rn02_00265497 predicted 1138
7 SASI_Rn01_00097134 predicted 688
8 SASI_Rn01_00097135 predicted 1116
9 SASI_Rn02_00265498 predicted 1531
10 SASI_Rn02_00265499 predicted 831
11 SASI_Rn01_00097127 predicted 1227
12 SASI_Rn01_00097128 predicted 1199
13 SASI_Rn01_00097130 predicted 2256
14 SASI_Rn01_00097131 predicted 2397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021103 predicted 600
2 SASI_Mm01_00021104 predicted 1509
3 SASI_Mm01_00021105 predicted 1423
4 SASI_Mm01_00021106 predicted 1174
5 SASI_Mm02_00323708 predicted 1132
6 SASI_Mm01_00021108 predicted 950
7 SASI_Mm01_00021109 predicted 891
8 SASI_Mm01_00021110 predicted 1320
9 SASI_Mm01_00021111 predicted 1731
10 SASI_Mm02_00323709 predicted 1105
11 SASI_Mm01_00021102 predicted 2654
12 SASI_Mm01_00021107 predicted 2395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000828
GRIA3 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000828.4-1712s21c1
Sequence:CCGGCATCGTTGGTGACGGGAAATACTCGAGTATTTCCCGTCACCAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000828.4-807s21c1
Sequence:CCGGTCCATCCTCCAAGCGATTATGCTCGAGCATAATCGCTTGGAGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-1063s1c1
Sequence:CCGGCCTATGGTTCAGCAGTTCATACTCGAGTATGAACTGCTGAACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-2785s1c1
Sequence:CCGGGCAGAGTCCAAACGCATGAAACTCGAGTTTCATGCGTTTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-2026s1c1
Sequence:CCGGCCTCCAAATGAATTTGGAATACTCGAGTATTCCAAATTCATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-877s1c1
Sequence:CCGGCGATACTTGATTGACTGCGAACTCGAGTTCGCAGTCAATCAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-393s1c1
Sequence:CCGGCGTGCAGTTATACAACACCAACTCGAGTTGGTGTTGTATAACTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000828
GRIA3 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000828.4-1712s21c1
Sequence:CCGGCATCGTTGGTGACGGGAAATACTCGAGTATTTCCCGTCACCAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000828.4-807s21c1
Sequence:CCGGTCCATCCTCCAAGCGATTATGCTCGAGCATAATCGCTTGGAGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-1063s1c1
Sequence:CCGGCCTATGGTTCAGCAGTTCATACTCGAGTATGAACTGCTGAACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-2785s1c1
Sequence:CCGGGCAGAGTCCAAACGCATGAAACTCGAGTTTCATGCGTTTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-2026s1c1
Sequence:CCGGCCTCCAAATGAATTTGGAATACTCGAGTATTCCAAATTCATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-877s1c1
Sequence:CCGGCGATACTTGATTGACTGCGAACTCGAGTTCGCAGTCAATCAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-393s1c1
Sequence:CCGGCGTGCAGTTATACAACACCAACTCGAGTTGGTGTTGTATAACTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000828
GRIA3 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000828.4-1712s21c1
Sequence:CCGGCATCGTTGGTGACGGGAAATACTCGAGTATTTCCCGTCACCAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000828.4-807s21c1
Sequence:CCGGTCCATCCTCCAAGCGATTATGCTCGAGCATAATCGCTTGGAGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-1063s1c1
Sequence:CCGGCCTATGGTTCAGCAGTTCATACTCGAGTATGAACTGCTGAACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-2785s1c1
Sequence:CCGGGCAGAGTCCAAACGCATGAAACTCGAGTTTCATGCGTTTGGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-2026s1c1
Sequence:CCGGCCTCCAAATGAATTTGGAATACTCGAGTATTCCAAATTCATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-877s1c1
Sequence:CCGGCGATACTTGATTGACTGCGAACTCGAGTTCGCAGTCAATCAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000828.2-393s1c1
Sequence:CCGGCGTGCAGTTATACAACACCAACTCGAGTTGGTGTTGTATAACTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016886
GRIA3 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016886.1-2790s1c1
Sequence:CCGGGAGCCAGATTTCACTCTCCTTCTCGAGAAGGAGAGTGAAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-1165s1c1
Sequence:CCGGCGTAGGACAAATTATACCATTCTCGAGAATGGTATAATTTGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-2281s1c1
Sequence:CCGGCCGTGTGATACGATGAAAGTTCTCGAGAACTTTCATCGTATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-1076s1c1
Sequence:CCGGCCTGGAGTCAAGGAATTGATACTCGAGTATCAATTCCTTGACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-2667s1c1
Sequence:CCGGCGCTACATACAGAGAAGGCTACTCGAGTAGCCTTCTCTGTATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016886
GRIA3 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016886.1-2790s1c1
Sequence:CCGGGAGCCAGATTTCACTCTCCTTCTCGAGAAGGAGAGTGAAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-1165s1c1
Sequence:CCGGCGTAGGACAAATTATACCATTCTCGAGAATGGTATAATTTGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-2281s1c1
Sequence:CCGGCCGTGTGATACGATGAAAGTTCTCGAGAACTTTCATCGTATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-1076s1c1
Sequence:CCGGCCTGGAGTCAAGGAATTGATACTCGAGTATCAATTCCTTGACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-2667s1c1
Sequence:CCGGCGCTACATACAGAGAAGGCTACTCGAGTAGCCTTCTCTGTATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016886
GRIA3 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016886.1-2790s1c1
Sequence:CCGGGAGCCAGATTTCACTCTCCTTCTCGAGAAGGAGAGTGAAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-1165s1c1
Sequence:CCGGCGTAGGACAAATTATACCATTCTCGAGAATGGTATAATTTGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-2281s1c1
Sequence:CCGGCCGTGTGATACGATGAAAGTTCTCGAGAACTTTCATCGTATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-1076s1c1
Sequence:CCGGCCTGGAGTCAAGGAATTGATACTCGAGTATCAATTCCTTGACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016886.1-2667s1c1
Sequence:CCGGCGCTACATACAGAGAAGGCTACTCGAGTAGCCTTCTCTGTATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks