EMAIL THIS PAGE TO A FRIEND

GRIA4

glutamate receptor, ionotropic, AMPA 4

313 Gene Product Result for
Synonyms: GLUR4 GLUR4C GLURD GluA4
UniProtKB ID: P48058, Q86XE8
Gene ID:
Human(2893) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. Some haplotypes of this gene show a positive association with schizophrenia. [provided by RefSeq, Jul 2008]
Mouse(14802) glutamate receptor, ionotropic, AMPA4 (alpha 4)
Rat(29629) glutamate receptor, ionotropic, AMPA 4
chicken(396137) glutamate receptor, ionotropic, AMPA 4
dog(489427) glutamate receptor, ionotropic, AMPA 4
Horse(100061561) glutamate receptor, ionotropic, AMPA 4
cow(529904) glutamate receptor, ionotrophic, AMPA 4
domestic cat(101087003) glutamate receptor, ionotropic, AMPA 4
domestic guinea pig(100728256) glutamate receptor, ionotropic, AMPA 4
naked mole-rat(101698538) glutamate receptor, ionotropic, AMPA 4
sheep(443274) glutamate receptor, ionotropic, AMPA 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501296 Anti-GLUR4, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB2500494 Anti-GRIA4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504187 Anti-phospho-GluR4 (pSer862) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C271 CX546 ≥98% (HPLC), solid human pricing
P5295 Piracetam human, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
C9847 Cyclothiazide human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000829 Rosetta Predictions human pricing
NM_001077243 Rosetta Predictions human pricing
NM_001077244 Rosetta Predictions human pricing
NM_001112812 Rosetta Predictions human pricing
NM_001113184 Rosetta Predictions rat pricing
NM_001113185 Rosetta Predictions rat pricing
NM_017263 Rosetta Predictions rat pricing
NM_001113180 Rosetta Predictions mouse pricing
NM_001113181 Rosetta Predictions mouse pricing
NM_019691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154072 predicted 1014
2 SASI_Hs01_00154075 predicted 1296
3 SASI_Hs01_00154076 predicted 826
4 SASI_Hs02_00303317 predicted 699
5 SASI_Hs02_00303318 predicted 780
6 SASI_Hs02_00303319 predicted 1085
7 SASI_Hs02_00303320 predicted 1488
8 SASI_Hs02_00303321 predicted 1296
9 SASI_Hs02_00303322 predicted 1169
10 SASI_Hs01_00154079 predicted 840
11 SASI_Hs01_00154071 predicted 1123
12 SASI_Hs01_00154073 predicted 1501
13 SASI_Hs01_00154074 predicted 1330
14 SASI_Hs01_00154077 predicted 1678
15 SASI_Hs01_00154078 predicted 2160
16 SASI_Hs01_00154080 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312294 predicted 1017
2 SASI_Hs02_00312295 predicted 1296
3 SASI_Hs02_00312296 predicted 829
4 SASI_Hs02_00312297 predicted 696
5 SASI_Hs02_00312298 predicted 779
6 SASI_Hs02_00312299 predicted 1078
7 SASI_Hs02_00312300 predicted 1480
8 SASI_Hs02_00312301 predicted 1300
9 SASI_Hs02_00312302 predicted 1166
10 SASI_Hs02_00312303 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312304 predicted 1020
2 SASI_Hs02_00312305 predicted 1293
3 SASI_Hs02_00312306 predicted 822
4 SASI_Hs02_00312307 predicted 698
5 SASI_Hs02_00312308 predicted 775
6 SASI_Hs02_00312309 predicted 1083
7 SASI_Hs02_00312310 predicted 1484
8 SASI_Hs02_00312311 predicted 1296
9 SASI_Hs02_00312312 predicted 1166
10 SASI_Hs02_00312313 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325575 predicted 888
2 SASI_Hs02_00325576 predicted 1160
3 SASI_Hs02_00325577 predicted 692
4 SASI_Hs02_00325578 predicted 566
5 SASI_Hs02_00325579 predicted 648
6 SASI_Hs02_00325580 predicted 953
7 SASI_Hs02_00325581 predicted 1355
8 SASI_Hs02_00325582 predicted 1165
9 SASI_Hs02_00325583 predicted 1032
10 SASI_Hs02_00325584 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251650 predicted 1036
2 SASI_Rn02_00251651 predicted 1050
3 SASI_Rn02_00251652 predicted 1177
4 SASI_Rn02_00251653 predicted 1228
5 SASI_Rn02_00251654 predicted 1292
6 SASI_Rn02_00251655 predicted 1489
7 SASI_Rn02_00251656 predicted 1062
8 SASI_Rn02_00251657 predicted 885
9 SASI_Rn02_00251658 predicted 1176
10 SASI_Rn02_00251659 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251660 predicted 1031
2 SASI_Rn02_00251661 predicted 1045
3 SASI_Rn02_00251662 predicted 1171
4 SASI_Rn02_00251663 predicted 1224
5 SASI_Rn02_00251664 predicted 1296
6 SASI_Rn02_00251665 predicted 1490
7 SASI_Rn02_00251666 predicted 1066
8 SASI_Rn02_00251667 predicted 883
9 SASI_Rn02_00251668 predicted 1179
10 SASI_Rn02_00251669 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075916 predicted 1038
2 SASI_Rn02_00261660 predicted 1047
3 SASI_Rn02_00261661 predicted 1174
4 SASI_Rn01_00075918 predicted 1221
5 SASI_Rn01_00075919 predicted 1300
6 SASI_Rn01_00075921 predicted 1491
7 SASI_Rn02_00261662 predicted 1064
8 SASI_Rn01_00075923 predicted 886
9 SASI_Rn02_00261663 predicted 1183
10 SASI_Rn02_00261664 predicted 1163
11 SASI_Rn01_00075915 predicted 1864
12 SASI_Rn01_00075917 predicted 2180
13 SASI_Rn01_00075920 predicted 1499
14 SASI_Rn01_00075922 predicted 1378
15 SASI_Rn01_00075924 predicted 1859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307153 predicted 1095
2 SASI_Mm02_00307154 predicted 1515
3 SASI_Mm02_00307155 predicted 870
4 SASI_Mm02_00307156 predicted 1004
5 SASI_Mm02_00307157 predicted 480
6 SASI_Mm02_00307158 predicted 1337
7 SASI_Mm02_00307159 predicted 1400
8 SASI_Mm02_00307160 predicted 1381
9 SASI_Mm02_00307161 predicted 1170
10 SASI_Mm02_00307162 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307163 predicted 1093
2 SASI_Mm02_00307164 predicted 1519
3 SASI_Mm02_00307165 predicted 868
4 SASI_Mm02_00307166 predicted 998
5 SASI_Mm02_00307167 predicted 482
6 SASI_Mm02_00307168 predicted 1343
7 SASI_Mm02_00307169 predicted 1398
8 SASI_Mm02_00307170 predicted 1387
9 SASI_Mm02_00307171 predicted 1171
10 SASI_Mm02_00307172 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127210 predicted 1092
2 SASI_Mm01_00127211 predicted 1518
3 SASI_Mm01_00127212 predicted 873
4 SASI_Mm02_00324783 predicted 1003
5 SASI_Mm02_00324784 predicted 483
6 SASI_Mm02_00324785 predicted 1344
7 SASI_Mm02_00324786 predicted 1400
8 SASI_Mm02_00324787 predicted 1385
9 SASI_Mm02_00324788 predicted 1172
10 SASI_Mm02_00324789 predicted 1213
11 SASI_Mm01_00127207 predicted 2090
12 SASI_Mm01_00127208 predicted 1553
13 SASI_Mm01_00127209 predicted 1554
14 SASI_Mm01_00127213 predicted 1565
15 SASI_Mm01_00127214 predicted 3123
16 SASI_Mm01_00127215 predicted 2160
17 SASI_Mm01_00127216 predicted 1890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000829
GRIA4 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-1676s1c1
Sequence:CCGGGCGTGGTCTTATTCCTAGTTACTCGAGTAACTAGGAATAAGACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-333s1c1
Sequence:CCGGCGCCTTACATATCTCCCTCATCTCGAGATGAGGGAGATATGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-925s1c1
Sequence:CCGGGCTGAAACTTTCCGAAGTCTTCTCGAGAAGACTTCGGAAAGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-2285s1c1
Sequence:CCGGCCTCATTAAGAACTCCTGTAACTCGAGTTACAGGAGTTCTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-2145s1c1
Sequence:CCGGCCGCAAATCCAAGGGCAAATTCTCGAGAATTTGCCCTTGGATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-1542s21c1
Sequence:CCGGTATGGACGTAGAGTCAATTACCTCGAGGTAATTGACTCTACGTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-979s21c1
Sequence:CCGGGTTGGCATGTCAGCGCTATATCTCGAGATATAGCGCTGACATGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000829.3-3470s21c1
Sequence:CCGGCTTATGAGTTAGCGCATTAAACTCGAGTTTAATGCGCTAACTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-3136s21c1
Sequence:CCGGTTGCATCGGACCTACCATAAACTCGAGTTTATGGTAGGTCCGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000829
GRIA4 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-1676s1c1
Sequence:CCGGGCGTGGTCTTATTCCTAGTTACTCGAGTAACTAGGAATAAGACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-333s1c1
Sequence:CCGGCGCCTTACATATCTCCCTCATCTCGAGATGAGGGAGATATGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-925s1c1
Sequence:CCGGGCTGAAACTTTCCGAAGTCTTCTCGAGAAGACTTCGGAAAGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-2285s1c1
Sequence:CCGGCCTCATTAAGAACTCCTGTAACTCGAGTTACAGGAGTTCTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-2145s1c1
Sequence:CCGGCCGCAAATCCAAGGGCAAATTCTCGAGAATTTGCCCTTGGATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-1542s21c1
Sequence:CCGGTATGGACGTAGAGTCAATTACCTCGAGGTAATTGACTCTACGTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-979s21c1
Sequence:CCGGGTTGGCATGTCAGCGCTATATCTCGAGATATAGCGCTGACATGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000829.3-3470s21c1
Sequence:CCGGCTTATGAGTTAGCGCATTAAACTCGAGTTTAATGCGCTAACTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-3136s21c1
Sequence:CCGGTTGCATCGGACCTACCATAAACTCGAGTTTATGGTAGGTCCGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000829
GRIA4 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-1676s1c1
Sequence:CCGGGCGTGGTCTTATTCCTAGTTACTCGAGTAACTAGGAATAAGACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-333s1c1
Sequence:CCGGCGCCTTACATATCTCCCTCATCTCGAGATGAGGGAGATATGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-925s1c1
Sequence:CCGGGCTGAAACTTTCCGAAGTCTTCTCGAGAAGACTTCGGAAAGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-2285s1c1
Sequence:CCGGCCTCATTAAGAACTCCTGTAACTCGAGTTACAGGAGTTCTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000829.1-2145s1c1
Sequence:CCGGCCGCAAATCCAAGGGCAAATTCTCGAGAATTTGCCCTTGGATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-1542s21c1
Sequence:CCGGTATGGACGTAGAGTCAATTACCTCGAGGTAATTGACTCTACGTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-979s21c1
Sequence:CCGGGTTGGCATGTCAGCGCTATATCTCGAGATATAGCGCTGACATGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000829.3-3470s21c1
Sequence:CCGGCTTATGAGTTAGCGCATTAAACTCGAGTTTAATGCGCTAACTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000829.3-3136s21c1
Sequence:CCGGTTGCATCGGACCTACCATAAACTCGAGTTTATGGTAGGTCCGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019691
GRIA4 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, AMPA 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1635s1c1
Sequence:CCGGAGTGGTTGTAACCACAATTATCTCGAGATAATTGTGGTTACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1750s1c1
Sequence:CCGGGCGAAACATATCGGTATCAAACTCGAGTTTGATACCGATATGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-818s1c1
Sequence:CCGGGCCTCCTGGATCACTATGAATCTCGAGATTCATAGTGATCCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1219s1c1
Sequence:CCGGCGCTGGAAGAAACTAGATCAACTCGAGTTGATCTAGTTTCTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019691.2-3446s1c1
Sequence:CCGGGCCAGGGATCAACAGTTAATACTCGAGTATTAACTGTTGATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019691
GRIA4 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, AMPA 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1635s1c1
Sequence:CCGGAGTGGTTGTAACCACAATTATCTCGAGATAATTGTGGTTACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1750s1c1
Sequence:CCGGGCGAAACATATCGGTATCAAACTCGAGTTTGATACCGATATGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-818s1c1
Sequence:CCGGGCCTCCTGGATCACTATGAATCTCGAGATTCATAGTGATCCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1219s1c1
Sequence:CCGGCGCTGGAAGAAACTAGATCAACTCGAGTTGATCTAGTTTCTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019691.2-3446s1c1
Sequence:CCGGGCCAGGGATCAACAGTTAATACTCGAGTATTAACTGTTGATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019691
GRIA4 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, AMPA 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1635s1c1
Sequence:CCGGAGTGGTTGTAACCACAATTATCTCGAGATAATTGTGGTTACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1750s1c1
Sequence:CCGGGCGAAACATATCGGTATCAAACTCGAGTTTGATACCGATATGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-818s1c1
Sequence:CCGGGCCTCCTGGATCACTATGAATCTCGAGATTCATAGTGATCCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019691.2-1219s1c1
Sequence:CCGGCGCTGGAAGAAACTAGATCAACTCGAGTTGATCTAGTTTCTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019691.2-3446s1c1
Sequence:CCGGGCCAGGGATCAACAGTTAATACTCGAGTATTAACTGTTGATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks