EMAIL THIS PAGE TO A FRIEND

GRID1

glutamate receptor, ionotropic, delta 1

104 Gene Product Result for
Synonyms: GluD1
UniProtKB ID: Q9ULK0, B3KXD5, Q8IXT3
Gene ID:
Human(2894) Summary: This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
Mouse(14803) glutamate receptor, ionotropic, delta 1
Rat(79219) glutamate receptor, ionotropic, delta 1
Zebrafish(793756) glutamate receptor, ionotropic, delta 1
cow(100337106) glutamate receptor, ionotropic, delta 1
chicken(428934) glutamate receptor, ionotropic, delta 1
dog(489075) glutamate receptor, ionotropic, delta 1
Horse(100064635) glutamate receptor, ionotropic, delta 1
domestic cat(101088275) glutamate receptor, ionotropic, delta 1
sheep(101114332) glutamate receptor, ionotropic, delta 1
domestic guinea pig(100724914) glutamate receptor, ionotropic, delta 1
naked mole-rat(101703012) glutamate receptor, ionotropic, delta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_043613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_043613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_043613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017551 Rosetta Predictions human pricing
NM_024378 Rosetta Predictions rat pricing
NM_008166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209516 predicted 1257
2 SASI_Hs01_00209517 predicted 2124
3 SASI_Hs01_00209518 predicted 1056
4 SASI_Hs01_00209519 predicted 1480
5 SASI_Hs01_00209520 predicted 2759
6 SASI_Hs01_00209521 predicted 704
7 SASI_Hs01_00209522 predicted 944
8 SASI_Hs01_00209523 predicted 1831
9 SASI_Hs01_00209524 predicted 2021
10 SASI_Hs01_00209525 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093569 predicted 1519
2 SASI_Rn01_00093570 predicted 1295
3 SASI_Rn01_00093571 predicted 1561
4 SASI_Rn01_00093572 predicted 1173
5 SASI_Rn02_00263971 predicted 1006
6 SASI_Rn01_00093574 predicted 1567
7 SASI_Rn01_00093575 predicted 2603
8 SASI_Rn01_00093576 predicted 2056
9 SASI_Rn01_00093578 predicted 2304
10 SASI_Rn02_00263972 predicted 636
11 SASI_Rn01_00093573 predicted 2873
12 SASI_Rn01_00093577 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091138 predicted 1470
2 SASI_Mm01_00091140 predicted 2959
3 SASI_Mm01_00091145 predicted 1241
4 SASI_Mm01_00091142 predicted 2010
5 SASI_Mm02_00313278 predicted 223
6 SASI_Mm01_00091143 predicted 2827
7 SASI_Mm02_00313279 predicted 2551
8 SASI_Mm01_00091147 predicted 2270
9 SASI_Mm02_00313280 predicted 1269
10 SASI_Mm02_00313281 predicted 2252
11 SASI_Mm01_00091139 predicted 1887
12 SASI_Mm01_00091141 predicted 913
13 SASI_Mm01_00091144 predicted 562
14 SASI_Mm01_00091146 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008166
GRID1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, delta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1419s1c1
Sequence:CCGGGCTGAGAATATCCTTGGACAACTCGAGTTGTCCAAGGATATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1794s1c1
Sequence:CCGGGTGCTCATATTCGTGTTGAATCTCGAGATTCAACACGAATATGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-575s1c1
Sequence:CCGGCGAGTATGATATCCGTGGGTTCTCGAGAACCCACGGATATCATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1446s1c1
Sequence:CCGGCGTTACAAAGGGTTCTCCATACTCGAGTATGGAGAACCCTTTGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1793s1c1
Sequence:CCGGCGTGCTCATATTCGTGTTGAACTCGAGTTCAACACGAATATGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008166
GRID1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, delta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1419s1c1
Sequence:CCGGGCTGAGAATATCCTTGGACAACTCGAGTTGTCCAAGGATATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1794s1c1
Sequence:CCGGGTGCTCATATTCGTGTTGAATCTCGAGATTCAACACGAATATGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-575s1c1
Sequence:CCGGCGAGTATGATATCCGTGGGTTCTCGAGAACCCACGGATATCATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1446s1c1
Sequence:CCGGCGTTACAAAGGGTTCTCCATACTCGAGTATGGAGAACCCTTTGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1793s1c1
Sequence:CCGGCGTGCTCATATTCGTGTTGAACTCGAGTTCAACACGAATATGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008166
GRID1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, delta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1419s1c1
Sequence:CCGGGCTGAGAATATCCTTGGACAACTCGAGTTGTCCAAGGATATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1794s1c1
Sequence:CCGGGTGCTCATATTCGTGTTGAATCTCGAGATTCAACACGAATATGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-575s1c1
Sequence:CCGGCGAGTATGATATCCGTGGGTTCTCGAGAACCCACGGATATCATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1446s1c1
Sequence:CCGGCGTTACAAAGGGTTCTCCATACTCGAGTATGGAGAACCCTTTGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008166.1-1793s1c1
Sequence:CCGGCGTGCTCATATTCGTGTTGAACTCGAGTTCAACACGAATATGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_043613
GRID1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, delta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1485s1c1
Sequence:CCGGCGCTACAAAGGGTTCTCCATACTCGAGTATGGAGAACCCTTTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-695s1c1
Sequence:CCGGCAAGAACATTAGCCACGTATTCTCGAGAATACGTGGCTAATGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1294s1c1
Sequence:CCGGGCACTACCTATAGTGAGACTTCTCGAGAAGTCTCACTATAGGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1768s1c1
Sequence:CCGGCCCTCTTTGCTCCATTTGATTCTCGAGAATCAAATGGAGCAAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-947s1c1
Sequence:CCGGGCAAATCTTTCCGTCTGCAAACTCGAGTTTGCAGACGGAAAGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_043613
GRID1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, delta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1485s1c1
Sequence:CCGGCGCTACAAAGGGTTCTCCATACTCGAGTATGGAGAACCCTTTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-695s1c1
Sequence:CCGGCAAGAACATTAGCCACGTATTCTCGAGAATACGTGGCTAATGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1294s1c1
Sequence:CCGGGCACTACCTATAGTGAGACTTCTCGAGAAGTCTCACTATAGGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1768s1c1
Sequence:CCGGCCCTCTTTGCTCCATTTGATTCTCGAGAATCAAATGGAGCAAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-947s1c1
Sequence:CCGGGCAAATCTTTCCGTCTGCAAACTCGAGTTTGCAGACGGAAAGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_043613
GRID1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, delta 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1485s1c1
Sequence:CCGGCGCTACAAAGGGTTCTCCATACTCGAGTATGGAGAACCCTTTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-695s1c1
Sequence:CCGGCAAGAACATTAGCCACGTATTCTCGAGAATACGTGGCTAATGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1294s1c1
Sequence:CCGGGCACTACCTATAGTGAGACTTCTCGAGAAGTCTCACTATAGGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-1768s1c1
Sequence:CCGGCCCTCTTTGCTCCATTTGATTCTCGAGAATCAAATGGAGCAAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043613.8-947s1c1
Sequence:CCGGGCAAATCTTTCCGTCTGCAAACTCGAGTTTGCAGACGGAAAGATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)