EMAIL THIS PAGE TO A FRIEND

GRID2

glutamate receptor, ionotropic, delta 2

63 Gene Product Result for
Synonyms: GluD2
UniProtKB ID: O43424, Q4KKU9, Q4KKV0, Q59FZ1
Gene ID:
Human(2895) Summary: Human glutamate receptor delta-2 (GRID2) is a relatively new member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. GRID2 is a predicted 1,007 amino acid protein that shares 97% identity with the mouse homolog which is expressed selectively in cerebellar Purkinje cells. A point mutation in mouse GRID2, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This strongly suggests a role for GRID2 in neuronal apoptotic death. [provided by RefSeq, Jul 2008]
Mouse(14804) glutamate receptor, ionotropic, delta 2
Rat(79220) glutamate receptor, ionotropic, delta 2
Zebrafish(448841) glutamate receptor, ionotropic, delta 2
cow(536367) glutamate receptor, ionotropic, delta 2
Horse(100053364) glutamate receptor, ionotropic, delta 2
domestic cat(101084622) glutamate receptor, ionotropic, delta 2
dog(487863) glutamate receptor, ionotropic, delta 2
chicken(422520) glutamate receptor, ionotropic, delta 2
domestic guinea pig(100735199) glutamate receptor, ionotropic, delta 2
naked mole-rat(101702643) glutamate receptor, ionotropic, delta 2
sheep(101117078) glutamate receptor, ionotropic, delta 2
Domestic Rabbit(100342468) glutamate receptor, ionotropic, delta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001510 Rosetta Predictions human pricing
NM_024379 Rosetta Predictions rat pricing
XM_579489 Rosetta Predictions rat pricing
NM_008167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045692 predicted 1087
2 SASI_Hs01_00045693 predicted 1578
3 SASI_Hs01_00045694 predicted 770
4 SASI_Hs01_00045695 predicted 2286
5 SASI_Hs02_00332012 predicted 3009
6 SASI_Hs01_00045696 predicted 2653
7 SASI_Hs02_00332013 predicted 823
8 SASI_Hs01_00045697 predicted 991
9 SASI_Hs01_00045698 predicted 1954
10 SASI_Hs01_00045701 predicted 2887
11 SASI_Hs01_00045699 predicted 2305
12 SASI_Hs01_00045700 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042352 predicted 2109
2 SASI_Rn02_00263973 predicted 2231
3 SASI_Rn01_00042353 predicted 2708
4 SASI_Rn01_00042354 predicted 3390
5 SASI_Rn01_00042355 predicted 2182
6 SASI_Rn01_00042356 predicted 1825
7 SASI_Rn01_00042357 predicted 1737
8 SASI_Rn01_00042358 predicted 2223
9 SASI_Rn01_00042359 predicted 460
10 SASI_Rn01_00042360 predicted 1022
11 SASI_Rn01_00042361 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147707 predicted 1559
2 SASI_Rn01_00147708 predicted 1677
3 SASI_Rn01_00147709 predicted 1322
4 SASI_Rn01_00147710 predicted 1551
5 SASI_Rn01_00147711 predicted 2157
6 SASI_Rn01_00147712 predicted 329
7 SASI_Rn01_00147713 predicted 393
8 SASI_Rn01_00147714 predicted 1633
9 SASI_Rn01_00147715 predicted 1276
10 SASI_Rn01_00147716 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313282 predicted 507
2 SASI_Mm01_00152545 predicted 1923
3 SASI_Mm01_00152546 predicted 809
4 SASI_Mm01_00152547 predicted 403
5 SASI_Mm01_00152548 predicted 2262
6 SASI_Mm01_00152549 predicted 514
7 SASI_Mm01_00152550 predicted 1805
8 SASI_Mm01_00152551 predicted 1431
9 SASI_Mm01_00152552 predicted 1621
10 SASI_Mm02_00313283 predicted 2084
11 SASI_Mm01_00152544 predicted 949
12 SASI_Mm01_00152553 predicted 1914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001510
GRID2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, delta 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-491s1c1
Sequence:CCGGCCTGGCAGAAATTCATTATATCTCGAGATATAATGAATTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-2473s1c1
Sequence:CCGGGCCCTGGACATAAAGAGCTTTCTCGAGAAAGCTCTTTATGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-906s1c1
Sequence:CCGGCCATCGAATATCTTCAACATTCTCGAGAATGTTGAAGATATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-244s1c1
Sequence:CCGGGCCTGTGAACTTATGAATCAACTCGAGTTGATTCATAAGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-2625s1c1
Sequence:CCGGGCACCTCCATAGACGTGTAAACTCGAGTTTACACGTCTATGGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-3020s21c1
Sequence:CCGGATTTCAGGAACACTCATATTACTCGAGTAATATGAGTGTTCCTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-2302s21c1
Sequence:CCGGGTCCTAGACTCTGCGGTATATCTCGAGATATACCGCAGAGTCTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-1019s21c1
Sequence:CCGGTTGACTGTCACTGGATCATTACTCGAGTAATGATCCAGTGACAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001510
GRID2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, delta 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-491s1c1
Sequence:CCGGCCTGGCAGAAATTCATTATATCTCGAGATATAATGAATTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-2473s1c1
Sequence:CCGGGCCCTGGACATAAAGAGCTTTCTCGAGAAAGCTCTTTATGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-906s1c1
Sequence:CCGGCCATCGAATATCTTCAACATTCTCGAGAATGTTGAAGATATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-244s1c1
Sequence:CCGGGCCTGTGAACTTATGAATCAACTCGAGTTGATTCATAAGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-2625s1c1
Sequence:CCGGGCACCTCCATAGACGTGTAAACTCGAGTTTACACGTCTATGGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-3020s21c1
Sequence:CCGGATTTCAGGAACACTCATATTACTCGAGTAATATGAGTGTTCCTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-2302s21c1
Sequence:CCGGGTCCTAGACTCTGCGGTATATCTCGAGATATACCGCAGAGTCTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-1019s21c1
Sequence:CCGGTTGACTGTCACTGGATCATTACTCGAGTAATGATCCAGTGACAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001510
GRID2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, delta 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-491s1c1
Sequence:CCGGCCTGGCAGAAATTCATTATATCTCGAGATATAATGAATTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-2473s1c1
Sequence:CCGGGCCCTGGACATAAAGAGCTTTCTCGAGAAAGCTCTTTATGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-906s1c1
Sequence:CCGGCCATCGAATATCTTCAACATTCTCGAGAATGTTGAAGATATTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-244s1c1
Sequence:CCGGGCCTGTGAACTTATGAATCAACTCGAGTTGATTCATAAGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001510.1-2625s1c1
Sequence:CCGGGCACCTCCATAGACGTGTAAACTCGAGTTTACACGTCTATGGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-3020s21c1
Sequence:CCGGATTTCAGGAACACTCATATTACTCGAGTAATATGAGTGTTCCTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-2302s21c1
Sequence:CCGGGTCCTAGACTCTGCGGTATATCTCGAGATATACCGCAGAGTCTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001510.2-1019s21c1
Sequence:CCGGTTGACTGTCACTGGATCATTACTCGAGTAATGATCCAGTGACAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008167
GRID2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, delta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-1431s1c1
Sequence:CCGGCCTATCTAACTACCTGGGTTTCTCGAGAAACCCAGGTAGTTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-709s1c1
Sequence:CCGGGCCACAGCCAAATCCTTCATACTCGAGTATGAAGGATTTGGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-1797s1c1
Sequence:CCGGGATGACATCTACTACACTCTACTCGAGTAGAGTGTAGTAGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-66s1c1
Sequence:CCGGCGCTGATTCTATCATCCACATCTCGAGATGTGGATGATAGAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-407s1c1
Sequence:CCGGGCAACAGAAATGATGACTATACTCGAGTATAGTCATCATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008167
GRID2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, delta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-1431s1c1
Sequence:CCGGCCTATCTAACTACCTGGGTTTCTCGAGAAACCCAGGTAGTTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-709s1c1
Sequence:CCGGGCCACAGCCAAATCCTTCATACTCGAGTATGAAGGATTTGGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-1797s1c1
Sequence:CCGGGATGACATCTACTACACTCTACTCGAGTAGAGTGTAGTAGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-66s1c1
Sequence:CCGGCGCTGATTCTATCATCCACATCTCGAGATGTGGATGATAGAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-407s1c1
Sequence:CCGGGCAACAGAAATGATGACTATACTCGAGTATAGTCATCATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008167
GRID2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, delta 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-1431s1c1
Sequence:CCGGCCTATCTAACTACCTGGGTTTCTCGAGAAACCCAGGTAGTTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-709s1c1
Sequence:CCGGGCCACAGCCAAATCCTTCATACTCGAGTATGAAGGATTTGGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-1797s1c1
Sequence:CCGGGATGACATCTACTACACTCTACTCGAGTAGAGTGTAGTAGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-66s1c1
Sequence:CCGGCGCTGATTCTATCATCCACATCTCGAGATGTGGATGATAGAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008167.1-407s1c1
Sequence:CCGGGCAACAGAAATGATGACTATACTCGAGTATAGTCATCATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks