EMAIL THIS PAGE TO A FRIEND

GRID2IP

glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein

82 Gene Product Result for
Synonyms: DELPHILIN
UniProtKB ID: A4D2P6
Gene ID:
Human(392862) Summary: Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]
Mouse(170935) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Rat(288484) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
sheep(101106134) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
domestic guinea pig(100728238) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
naked mole-rat(101705094) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
chicken(427671) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
dog(609131) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
cow(518088) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
domestic cat(101100528) glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045381 Anti-GRID2IP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010181 MISSION® esiRNA esiRNA targeting mouse Grid2ip (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017146 Rosetta Predictions human pricing
XR_018117 Rosetta Predictions human pricing
XR_041837 Rosetta Predictions human pricing
XR_041838 Rosetta Predictions human pricing
NM_001105910 Rosetta Predictions rat pricing
NM_001038019 Rosetta Predictions mouse pricing
NM_133355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00492501 predicted 2777
2 SASI_Hs02_00492502 predicted 1681
3 SASI_Hs02_00492503 predicted 3405
4 SASI_Hs02_00492504 predicted 431
5 SASI_Hs02_00492505 predicted 1091
6 SASI_Hs02_00492506 predicted 1281
7 SASI_Hs02_00492507 predicted 3171
8 SASI_Hs02_00492508 predicted 3295
9 SASI_Hs02_00492509 predicted 1280
10 SASI_Hs02_00492510 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495406 predicted 2782
2 SASI_Hs02_00495407 predicted 1676
3 SASI_Hs02_00495408 predicted 3400
4 SASI_Hs02_00495409 predicted 433
5 SASI_Hs02_00495410 predicted 1093
6 SASI_Hs02_00495411 predicted 1280
7 SASI_Hs02_00495412 predicted 3166
8 SASI_Hs02_00495413 predicted 3290
9 SASI_Hs02_00495414 predicted 1275
10 SASI_Hs02_00495415 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530773 predicted 2774
2 SASI_Hs02_00530774 predicted 1674
3 SASI_Hs02_00530775 predicted 3402
4 SASI_Hs02_00530776 predicted 432
5 SASI_Hs02_00530777 predicted 1091
6 SASI_Hs02_00530778 predicted 1283
7 SASI_Hs02_00530779 predicted 3164
8 SASI_Hs02_00530780 predicted 3295
9 SASI_Hs02_00530781 predicted 1272
10 SASI_Hs02_00530782 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530783 predicted 2772
2 SASI_Hs02_00530784 predicted 1669
3 SASI_Hs02_00530785 predicted 3397
4 SASI_Hs02_00530786 predicted 427
5 SASI_Hs02_00530787 predicted 1091
6 SASI_Hs02_00530788 predicted 1284
7 SASI_Hs02_00530789 predicted 3161
8 SASI_Hs02_00530790 predicted 3289
9 SASI_Hs02_00530791 predicted 1274
10 SASI_Hs02_00530792 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213742 predicted 1148
2 SASI_Rn02_00213743 predicted 2174
3 SASI_Rn02_00213744 predicted 2330
4 SASI_Rn02_00213745 predicted 330
5 SASI_Rn02_00213746 predicted 2594
6 SASI_Rn02_00213747 predicted 2662
7 SASI_Rn02_00213748 predicted 2530
8 SASI_Rn02_00213749 predicted 902
9 SASI_Rn02_00213750 predicted 2326
10 SASI_Rn02_00213751 predicted 3201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159945 predicted 2592
2 SASI_Mm01_00159946 predicted 2237
3 SASI_Mm01_00159947 predicted 994
4 SASI_Mm01_00159948 predicted 686
5 SASI_Mm01_00159949 predicted 2696
6 SASI_Mm01_00159950 predicted 3090
7 SASI_Mm01_00159951 predicted 2982
8 SASI_Mm01_00159952 predicted 2386
9 SASI_Mm01_00159953 predicted 395
10 SASI_Mm01_00159954 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338539 predicted 2161
2 SASI_Mm01_00065534 predicted 2539
3 SASI_Mm01_00065535 predicted 2174
4 SASI_Mm01_00065536 predicted 928
5 SASI_Mm01_00065537 predicted 630
6 SASI_Mm01_00065538 predicted 2638
7 SASI_Mm01_00065539 predicted 3031
8 SASI_Mm01_00065540 predicted 2927
9 SASI_Mm01_00065541 predicted 2335
10 SASI_Mm01_00065542 predicted 329
11 SASI_Mm01_00065543 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145118
GRID2IP MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-2907s21c1
Sequence:CCGGGATGCTGTCAGTTCCCGAATACTCGAGTATTCGGGAACTGACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-3122s21c1
Sequence:CCGGCGGGCTTCAAGATCAACTTTCCTCGAGGAAAGTTGATCTTGAAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-420s21c1
Sequence:CCGGCAGCCGCAAGGTGGATGAAATCTCGAGATTTCATCCACCTTGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145118.1-3938s21c1
Sequence:CCGGCCTGGAGGGTGGATTACAAAGCTCGAGCTTTGTAATCCACCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-3068s21c1
Sequence:CCGGTGTTGGCCATGGGCAACTATCCTCGAGGATAGTTGCCCATGGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145118
GRID2IP MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-2907s21c1
Sequence:CCGGGATGCTGTCAGTTCCCGAATACTCGAGTATTCGGGAACTGACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-3122s21c1
Sequence:CCGGCGGGCTTCAAGATCAACTTTCCTCGAGGAAAGTTGATCTTGAAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-420s21c1
Sequence:CCGGCAGCCGCAAGGTGGATGAAATCTCGAGATTTCATCCACCTTGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145118.1-3938s21c1
Sequence:CCGGCCTGGAGGGTGGATTACAAAGCTCGAGCTTTGTAATCCACCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-3068s21c1
Sequence:CCGGTGTTGGCCATGGGCAACTATCCTCGAGGATAGTTGCCCATGGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145118
GRID2IP MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-2907s21c1
Sequence:CCGGGATGCTGTCAGTTCCCGAATACTCGAGTATTCGGGAACTGACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-3122s21c1
Sequence:CCGGCGGGCTTCAAGATCAACTTTCCTCGAGGAAAGTTGATCTTGAAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-420s21c1
Sequence:CCGGCAGCCGCAAGGTGGATGAAATCTCGAGATTTCATCCACCTTGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145118.1-3938s21c1
Sequence:CCGGCCTGGAGGGTGGATTACAAAGCTCGAGCTTTGTAATCCACCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145118.1-3068s21c1
Sequence:CCGGTGTTGGCCATGGGCAACTATCCTCGAGGATAGTTGCCCATGGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133355
GRID2IP MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133355.1-3297s1c1
Sequence:CCGGCGAGTTCTGCTTGGCCCTCTTCTCGAGAAGAGGGCCAAGCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2064s1c1
Sequence:CCGGGCTGAGTGACATGGTGAAATACTCGAGTATTTCACCATGTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-551s1c1
Sequence:CCGGCGGTCCCTTTCGCCAGTGATTCTCGAGAATCACTGGCGAAAGGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2613s1c1
Sequence:CCGGCACTGGCTTCAAGATCAACTTCTCGAGAAGTTGATCTTGAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2180s1c1
Sequence:CCGGCCCACAAGAAGGCCTACAATACTCGAGTATTGTAGGCCTTCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133355
GRID2IP MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133355.1-3297s1c1
Sequence:CCGGCGAGTTCTGCTTGGCCCTCTTCTCGAGAAGAGGGCCAAGCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2064s1c1
Sequence:CCGGGCTGAGTGACATGGTGAAATACTCGAGTATTTCACCATGTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-551s1c1
Sequence:CCGGCGGTCCCTTTCGCCAGTGATTCTCGAGAATCACTGGCGAAAGGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2613s1c1
Sequence:CCGGCACTGGCTTCAAGATCAACTTCTCGAGAAGTTGATCTTGAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2180s1c1
Sequence:CCGGCCCACAAGAAGGCCTACAATACTCGAGTATTGTAGGCCTTCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133355
GRID2IP MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133355.1-3297s1c1
Sequence:CCGGCGAGTTCTGCTTGGCCCTCTTCTCGAGAAGAGGGCCAAGCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2064s1c1
Sequence:CCGGGCTGAGTGACATGGTGAAATACTCGAGTATTTCACCATGTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-551s1c1
Sequence:CCGGCGGTCCCTTTCGCCAGTGATTCTCGAGAATCACTGGCGAAAGGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2613s1c1
Sequence:CCGGCACTGGCTTCAAGATCAACTTCTCGAGAAGTTGATCTTGAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133355.1-2180s1c1
Sequence:CCGGCCCACAAGAAGGCCTACAATACTCGAGTATTGTAGGCCTTCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks