EMAIL THIS PAGE TO A FRIEND

GRIFIN

galectin-related inter-fiber protein

47 Gene Product Result for
UniProtKB ID: A4D1Z8
Gene ID:
Mouse(77998) galectin-related inter-fiber protein
Rat(117130) galectin-related inter-fiber protein
Zebrafish(445036) galectin related inter-fiber protein
cow(528362) galectin-related inter-fiber protein
dog(489892) grifin-like
chicken(427660) galectin-related inter-fiber protein
domestic guinea pig(100307059) galectin-related inter-fiber protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU147601 MISSION® esiRNA esiRNA targeting mouse Grifin mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099942 Rosetta Predictions human pricing
NM_057187 Rosetta Predictions rat pricing
NM_030022 Rosetta Predictions mouse pricing
XM_132470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321594 predicted 495
2 SASI_Hs02_00321595 predicted 381
3 SASI_Hs02_00321596 predicted 442
4 SASI_Hs02_00321597 predicted 297
5 SASI_Hs02_00321598 predicted 289
6 SASI_Hs02_00321599 predicted 486
7 SASI_Hs02_00321600 predicted 293
8 SASI_Hs02_00321601 predicted 363
9 SASI_Hs02_00321602 predicted 379
10 SASI_Hs02_00321603 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043441 predicted 290
2 SASI_Rn01_00043442 predicted 361
3 SASI_Rn01_00043443 predicted 353
4 SASI_Rn02_00267137 predicted 333
5 SASI_Rn01_00043444 predicted 323
6 SASI_Rn01_00043445 predicted 324
7 SASI_Rn01_00043448 predicted 272
8 SASI_Rn01_00043449 predicted 275
9 SASI_Rn01_00043450 predicted 262
10 SASI_Rn02_00267138 predicted 307
11 SASI_Rn01_00043446 predicted 356
12 SASI_Rn01_00043447 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336389 predicted 296
2 SASI_Mm02_00336390 predicted 284
3 SASI_Mm02_00336391 predicted 254
4 SASI_Mm02_00336392 predicted 276
5 SASI_Mm02_00336393 predicted 274
6 SASI_Mm02_00336394 predicted 229
7 SASI_Mm02_00336395 predicted 213
8 SASI_Mm02_00336396 predicted 278
9 SASI_Mm02_00336397 predicted 238
10 SASI_Mm02_00336398 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249686 predicted 304
2 SASI_Mm01_00249687 predicted 286
3 SASI_Mm01_00249688 predicted 254
4 SASI_Mm01_00249689 predicted 281
5 SASI_Mm01_00249690 predicted 281
6 SASI_Mm01_00249691 predicted 227
7 SASI_Mm01_00249692 predicted 214
8 SASI_Mm01_00249693 predicted 247
9 SASI_Mm01_00249694 predicted 284
10 SASI_Mm01_00249695 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030022
GRIFIN MISSION shRNA Bacterial Glycerol Stock
galectin-related inter-fiber protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-139s21c1
Sequence:CCGGACATCGCCTTCCACGTCAAACCTCGAGGTTTGACGTGGAAGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-283s21c1
Sequence:CCGGACGCAGAACACTTCCACATTTCTCGAGAAATGTGGAAGTGTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-259s21c1
Sequence:CCGGCCTTTGAGATGGAGGTGAGTGCTCGAGCACTCACCTCCATCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-107s21c1
Sequence:CCGGGTTCGAGATCAACTTCTTAACCTCGAGGTTAAGAAGTTGATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-218s21c1
Sequence:CCGGGGAGGAGGTGTCCAGCATATTCTCGAGAATATGCTGGACACCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030022
GRIFIN MISSION shRNA shRNA Plasmid DNA
galectin-related inter-fiber protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-139s21c1
Sequence:CCGGACATCGCCTTCCACGTCAAACCTCGAGGTTTGACGTGGAAGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-283s21c1
Sequence:CCGGACGCAGAACACTTCCACATTTCTCGAGAAATGTGGAAGTGTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-259s21c1
Sequence:CCGGCCTTTGAGATGGAGGTGAGTGCTCGAGCACTCACCTCCATCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-107s21c1
Sequence:CCGGGTTCGAGATCAACTTCTTAACCTCGAGGTTAAGAAGTTGATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-218s21c1
Sequence:CCGGGGAGGAGGTGTCCAGCATATTCTCGAGAATATGCTGGACACCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030022
GRIFIN MISSION shRNA Lentiviral Transduction Particles
galectin-related inter-fiber protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-139s21c1
Sequence:CCGGACATCGCCTTCCACGTCAAACCTCGAGGTTTGACGTGGAAGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-283s21c1
Sequence:CCGGACGCAGAACACTTCCACATTTCTCGAGAAATGTGGAAGTGTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-259s21c1
Sequence:CCGGCCTTTGAGATGGAGGTGAGTGCTCGAGCACTCACCTCCATCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-107s21c1
Sequence:CCGGGTTCGAGATCAACTTCTTAACCTCGAGGTTAAGAAGTTGATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030022.1-218s21c1
Sequence:CCGGGGAGGAGGTGTCCAGCATATTCTCGAGAATATGCTGGACACCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks