EMAIL THIS PAGE TO A FRIEND

GRIK1

glutamate receptor, ionotropic, kainate 1

153 Gene Product Result for
Synonyms: EAA3 EEA3 GLR5 GLUR5 GluK1
UniProtKB ID: P39086, Q13001, Q86SU9
Gene ID:
Human(2897) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(14805) glutamate receptor, ionotropic, kainate 1
Rat(29559) glutamate receptor, ionotropic, kainate 1
sheep(101107319) glutamate receptor, ionotropic, kainate 1
Domestic Rabbit(100354052) glutamate receptor, ionotropic, kainate 1
domestic guinea pig(100735908) glutamate receptor, ionotropic, kainate 1
naked mole-rat(101705989) glutamate receptor, ionotropic, kainate 1
Thale Cress(823660) serine/threonine-protein kinase GRIK1
dog(487719) glutamate receptor, ionotropic, kainate 1
cow(533760) glutamate receptor, ionotropic, kainate 1
Horse(100053602) glutamate receptor, ionotropic, kainate 1
domestic cat(101097165) glutamate receptor, ionotropic, kainate 1
chicken(418489) glutamate receptor, ionotropic, kainate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501299 Anti-GLUR5, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2500467 Anti-GLUR5/GRIK1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
PRS4381 Anti-Grik1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4383 Anti-Grik1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D6152 Domoic acid ≥90% (HPLC) human pricing
G111 γ-D-Glutamylaminomethylsulfonic acid solid human pricing
N183 NBQX disodium salt hydrate ≥98% (HPLC), lyophilized solid human pricing
N7787 NS3694 ≥98%, powder human pricing
A0326 (S)-AMPA ≥98% human, mouse, rat pricing
D138 5,7-Dichlorokynurenic acid monohydrate solid, ≥98% (HPLC) human, mouse, rat pricing
D0540 DNQX ≥98% (TLC) human, mouse, rat pricing
K0250 Kainic acid monohydrate ≥99% (TLC) human, mouse, rat pricing
G137 (2S,4R)-4-Methylglutamic acid solid human, rat pricing
324817 (Aminomethyl)phosphonic acid 99% human, rat pricing
MET12133A (Aminomethyl)phosphonic acid analytical standard human, rat pricing
A263 ATPA solid human, rat pricing
A7845 ATPO solid human, rat pricing
G120 GYKI 52895 solid human, rat pricing
K3375 Kynurenic acid ≥98% human, rat pricing
G5667 L-Glutamic acid PharmaGrade, Ajinomoto, EP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
W328502 L-Glutamic acid 99%, FCC human, rat pricing
G8415 L-Glutamic acid from non-animal source, meets EP testing specifications, suitable for cell culture, 98.5-100.5% human, rat pricing
49449 L-Glutamic acid BioUltra, ≥99.5% (NT) human, rat pricing
G1251 L-Glutamic acid ReagentPlus®, ≥99% (HPLC) human, rat pricing
09581 L-Glutamic acid tested according to Ph.Eur. human, rat pricing
M3262 N-Methyl-D-aspartic acid ≥98% (TLC), solid human, rat pricing
A8054 D(−)-2-Amino-5-phosphonopentanoic acid NMDA receptor antagonist mouse, rat pricing
A6816 (±)-AMPA solid rat pricing
144789 2,3-Dihydroxyquinoxaline 98% rat pricing
657239 6-Nitro-2,3-dihydroxyquinoxaline 96% rat pricing
C127 CNQX ≥98% (HPLC), solid rat pricing
A5282 DL-2-Amino-5-phosphonopentanoic acid solid rat pricing
A6553 DL-2-Amino-5-phosphonovaleric acid lithium salt ~95% rat pricing
P7575 L-trans-Pyrrolidine-2,4-dicarboxylic acid ≥98% rat pricing
M3387 N-Methyl-L-aspartic acid rat pricing
Q2128 Quisqualic acid powder rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000830 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000830 Rosetta Predictions human pricing
NM_175611 Rosetta Predictions human pricing
NM_001111114 Rosetta Predictions rat pricing
NM_001111117 Rosetta Predictions rat pricing
NM_017241 Rosetta Predictions rat pricing
NM_010348 Rosetta Predictions mouse pricing
NM_146072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239702 predicted 2530
2 SASI_Hs01_00239703 predicted 2376
3 SASI_Hs01_00239704 predicted 1328
4 SASI_Hs01_00239705 predicted 2556
5 SASI_Hs01_00239706 predicted 2003
6 SASI_Hs01_00239707 predicted 2405
7 SASI_Hs01_00239708 predicted 1184
8 SASI_Hs01_00239709 predicted 1081
9 SASI_Hs01_00239711 predicted 2514
10 SASI_Hs02_00303323 predicted 956
11 SASI_Hs01_00239710 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101415 predicted 2478
2 SASI_Hs01_00101416 predicted 2324
3 SASI_Hs01_00101417 predicted 1325
4 SASI_Hs01_00101418 predicted 2510
5 SASI_Hs01_00101419 predicted 1961
6 SASI_Hs01_00101420 predicted 2361
7 SASI_Hs01_00101421 predicted 1180
8 SASI_Hs01_00101422 predicted 1085
9 SASI_Hs01_00101424 predicted 2475
10 SASI_Hs02_00369014 predicted 951
11 SASI_Hs01_00101423 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251492 predicted 1987
2 SASI_Rn02_00251493 predicted 2946
3 SASI_Rn02_00251494 predicted 665
4 SASI_Rn02_00251495 predicted 1161
5 SASI_Rn02_00251496 predicted 1013
6 SASI_Rn02_00251497 predicted 357
7 SASI_Rn02_00251498 predicted 2176
8 SASI_Rn02_00251499 predicted 973
9 SASI_Rn02_00251500 predicted 881
10 SASI_Rn02_00251501 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251512 predicted 2041
2 SASI_Rn02_00251513 predicted 3077
3 SASI_Rn02_00251514 predicted 670
4 SASI_Rn02_00251515 predicted 1155
5 SASI_Rn02_00251516 predicted 1017
6 SASI_Rn02_00251517 predicted 353
7 SASI_Rn02_00251518 predicted 2226
8 SASI_Rn02_00251519 predicted 968
9 SASI_Rn02_00251520 predicted 879
10 SASI_Rn02_00251521 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261613 predicted 2034
2 SASI_Rn01_00080913 predicted 2988
3 SASI_Rn02_00261614 predicted 664
4 SASI_Rn01_00080914 predicted 1163
5 SASI_Rn01_00080916 predicted 1020
6 SASI_Rn01_00080917 predicted 356
7 SASI_Rn01_00080918 predicted 2224
8 SASI_Rn01_00080920 predicted 974
9 SASI_Rn02_00261615 predicted 882
10 SASI_Rn02_00261616 predicted 931
11 SASI_Rn01_00080912 predicted 880
12 SASI_Rn01_00080915 predicted 1577
13 SASI_Rn01_00080919 predicted 1619
14 SASI_Rn01_00080921 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096050 predicted 1296
2 SASI_Mm01_00096051 predicted 1940
3 SASI_Mm01_00096052 predicted 3347
4 SASI_Mm01_00096053 predicted 1897
5 SASI_Mm01_00096054 predicted 1384
6 SASI_Mm01_00096055 predicted 1529
7 SASI_Mm01_00096056 predicted 727
8 SASI_Mm01_00096057 predicted 2666
9 SASI_Mm01_00096059 predicted 1851
10 SASI_Mm02_00318368 predicted 1923
11 SASI_Mm01_00096058 predicted 2221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341692 predicted 1294
2 SASI_Mm02_00341693 predicted 1938
3 SASI_Mm02_00341694 predicted 3427
4 SASI_Mm02_00341695 predicted 1903
5 SASI_Mm02_00341696 predicted 1384
6 SASI_Mm02_00341697 predicted 1529
7 SASI_Mm02_00341698 predicted 725
8 SASI_Mm02_00341699 predicted 2673
9 SASI_Mm02_00341700 predicted 1852
10 SASI_Mm02_00341701 predicted 1925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146072
GRIK1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146072.4-2308s21c1
Sequence:CCGGCACACCCTACGAGTGGTATAACTCGAGTTATACCACTCGTAGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146072.4-1591s21c1
Sequence:CCGGCCTGCAGTGCCATCGACATAACTCGAGTTATGTCGATGGCACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146072.1-2746s1c1
Sequence:CCGGGCCTGCATCTATTAAATTGAACTCGAGTTCAATTTAATAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-351s1c1
Sequence:CCGGGCTCTGGAAGTTCCACACATTCTCGAGAATGTGTGGAACTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1944s1c1
Sequence:CCGGGCTGCCTTCTTGACAGTAGAACTCGAGTTCTACTGTCAAGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1874s1c1
Sequence:CCGGGACCAGAATAGTTGGAGGAATCTCGAGATTCCTCCAACTATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1145s1c1
Sequence:CCGGCCTGGACATTATCAGTCTCAACTCGAGTTGAGACTGATAATGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146072
GRIK1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146072.4-2308s21c1
Sequence:CCGGCACACCCTACGAGTGGTATAACTCGAGTTATACCACTCGTAGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146072.4-1591s21c1
Sequence:CCGGCCTGCAGTGCCATCGACATAACTCGAGTTATGTCGATGGCACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146072.1-2746s1c1
Sequence:CCGGGCCTGCATCTATTAAATTGAACTCGAGTTCAATTTAATAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-351s1c1
Sequence:CCGGGCTCTGGAAGTTCCACACATTCTCGAGAATGTGTGGAACTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1944s1c1
Sequence:CCGGGCTGCCTTCTTGACAGTAGAACTCGAGTTCTACTGTCAAGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1874s1c1
Sequence:CCGGGACCAGAATAGTTGGAGGAATCTCGAGATTCCTCCAACTATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1145s1c1
Sequence:CCGGCCTGGACATTATCAGTCTCAACTCGAGTTGAGACTGATAATGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146072
GRIK1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146072.4-2308s21c1
Sequence:CCGGCACACCCTACGAGTGGTATAACTCGAGTTATACCACTCGTAGGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146072.4-1591s21c1
Sequence:CCGGCCTGCAGTGCCATCGACATAACTCGAGTTATGTCGATGGCACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146072.1-2746s1c1
Sequence:CCGGGCCTGCATCTATTAAATTGAACTCGAGTTCAATTTAATAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-351s1c1
Sequence:CCGGGCTCTGGAAGTTCCACACATTCTCGAGAATGTGTGGAACTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1944s1c1
Sequence:CCGGGCTGCCTTCTTGACAGTAGAACTCGAGTTCTACTGTCAAGAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1874s1c1
Sequence:CCGGGACCAGAATAGTTGGAGGAATCTCGAGATTCCTCCAACTATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146072.1-1145s1c1
Sequence:CCGGCCTGGACATTATCAGTCTCAACTCGAGTTGAGACTGATAATGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000830
GRIK1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-3135s21c1
Sequence:CCGGACTACTTTATCTACGGATTTACTCGAGTAAATCCGTAGATAAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-2261s21c1
Sequence:CCGGTACACCCTACGAGTGGTATAACTCGAGTTATACCACTCGTAGGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-676s21c1
Sequence:CCGGTGATGCCTAACACCACATTAACTCGAGTTAATGTGGTGTTAGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-2355s1c1
Sequence:CCGGCCAGAATAGTTGGAGGGATATCTCGAGATATCCCTCCAACTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-1202s1c1
Sequence:CCGGGCTTTGGATCTGGAACTCTATCTCGAGATAGAGTTCCAGATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-785s1c1
Sequence:CCGGGCTCTCGAAGTTCCACACATACTCGAGTATGTGTGGAACTTCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-2870s1c1
Sequence:CCGGCCCGAGGAAGACAACAAAGAACTCGAGTTCTTTGTTGTCTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-1954s1c1
Sequence:CCGGCGGGATGGTTAAAGAACTCATCTCGAGATGAGTTCTTTAACCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000830
GRIK1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-3135s21c1
Sequence:CCGGACTACTTTATCTACGGATTTACTCGAGTAAATCCGTAGATAAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-2261s21c1
Sequence:CCGGTACACCCTACGAGTGGTATAACTCGAGTTATACCACTCGTAGGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-676s21c1
Sequence:CCGGTGATGCCTAACACCACATTAACTCGAGTTAATGTGGTGTTAGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-2355s1c1
Sequence:CCGGCCAGAATAGTTGGAGGGATATCTCGAGATATCCCTCCAACTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-1202s1c1
Sequence:CCGGGCTTTGGATCTGGAACTCTATCTCGAGATAGAGTTCCAGATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-785s1c1
Sequence:CCGGGCTCTCGAAGTTCCACACATACTCGAGTATGTGTGGAACTTCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-2870s1c1
Sequence:CCGGCCCGAGGAAGACAACAAAGAACTCGAGTTCTTTGTTGTCTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-1954s1c1
Sequence:CCGGCGGGATGGTTAAAGAACTCATCTCGAGATGAGTTCTTTAACCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000830
GRIK1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-3135s21c1
Sequence:CCGGACTACTTTATCTACGGATTTACTCGAGTAAATCCGTAGATAAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-2261s21c1
Sequence:CCGGTACACCCTACGAGTGGTATAACTCGAGTTATACCACTCGTAGGGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000830.3-676s21c1
Sequence:CCGGTGATGCCTAACACCACATTAACTCGAGTTAATGTGGTGTTAGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-2355s1c1
Sequence:CCGGCCAGAATAGTTGGAGGGATATCTCGAGATATCCCTCCAACTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-1202s1c1
Sequence:CCGGGCTTTGGATCTGGAACTCTATCTCGAGATAGAGTTCCAGATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-785s1c1
Sequence:CCGGGCTCTCGAAGTTCCACACATACTCGAGTATGTGTGGAACTTCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-2870s1c1
Sequence:CCGGCCCGAGGAAGACAACAAAGAACTCGAGTTCTTTGTTGTCTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000830.2-1954s1c1
Sequence:CCGGCGGGATGGTTAAAGAACTCATCTCGAGATGAGTTCTTTAACCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks