EMAIL THIS PAGE TO A FRIEND

GRIK2

glutamate receptor, ionotropic, kainate 2

113 Gene Product Result for
Synonyms: EAA4 GLR6 GLUK6 GLUR6 GluK2 MRT6
Gene ID:
Human(2898) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. Mutations in this gene have been associated with autosomal recessive mental retardation. [provided by RefSeq, Jul 2008]
Mouse(14806) glutamate receptor, ionotropic, kainate 2 (beta 2)
Rat(54257) glutamate receptor, ionotropic, kainate 2
Zebrafish(556013) glutamate receptor, ionotropic, kainate 2
Thale Cress(836176) geminivirus rep interacting kinase 2
dog(481938) glutamate receptor, ionotropic, kainate 2
cow(615226) glutamate receptor, ionotropic, kainate 2
chicken(428628) glutamate receptor, ionotropic, kainate 2
domestic guinea pig(100733104) glutamate receptor, ionotropic, kainate 2
naked mole-rat(101697577) glutamate receptor, ionotropic, kainate 2
sheep(101122701) glutamate receptor, ionotropic, kainate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
K0250 Kainic acid monohydrate ≥99% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021956 Rosetta Predictions human pricing
NM_175768 Rosetta Predictions human pricing
NM_019309 Rosetta Predictions rat pricing
XM_579430 Rosetta Predictions rat pricing
NM_001111268 Rosetta Predictions mouse pricing
NM_010349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047351 predicted 1659
2 SASI_Hs02_00355290 predicted 1505
3 SASI_Hs01_00047352 predicted 1999
4 SASI_Hs02_00355291 predicted 1067
5 SASI_Hs02_00355292 predicted 810
6 SASI_Hs01_00047354 predicted 1880
7 SASI_Hs01_00047355 predicted 822
8 SASI_Hs01_00047357 predicted 847
9 SASI_Hs01_00047359 predicted 1737
10 SASI_Hs02_00355293 predicted 2500
11 SASI_Hs01_00047350 predicted 2390
12 SASI_Hs01_00047353 predicted 285
13 SASI_Hs01_00047356 predicted 628
14 SASI_Hs01_00047358 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129836 predicted 1656
2 SASI_Hs02_00369112 predicted 1513
3 SASI_Hs01_00129837 predicted 1997
4 SASI_Hs02_00369113 predicted 1067
5 SASI_Hs02_00369114 predicted 810
6 SASI_Hs01_00129840 predicted 1880
7 SASI_Hs01_00129841 predicted 824
8 SASI_Hs01_00129843 predicted 851
9 SASI_Hs01_00129845 predicted 1734
10 SASI_Hs02_00369115 predicted 2504
11 SASI_Hs01_00129838 predicted 298
12 SASI_Hs01_00129839 predicted 287
13 SASI_Hs01_00129842 predicted 636
14 SASI_Hs01_00129844 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111670 predicted 1009
2 SASI_Rn01_00111671 predicted 1089
3 SASI_Rn02_00262274 predicted 1000
4 SASI_Rn01_00111672 predicted 513
5 SASI_Rn01_00111673 predicted 1541
6 SASI_Rn01_00111674 predicted 381
7 SASI_Rn01_00111675 predicted 691
8 SASI_Rn01_00111676 predicted 2505
9 SASI_Rn01_00111677 predicted 1959
10 SASI_Rn01_00111678 predicted 343
11 SASI_Rn01_00111679 predicted 2328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178937 predicted 619
2 SASI_Rn01_00178938 predicted 698
3 SASI_Rn01_00178939 predicted 1028
4 SASI_Rn01_00178940 predicted 614
5 SASI_Rn01_00178941 predicted 502
6 SASI_Rn01_00178942 predicted 1154
7 SASI_Rn01_00178943 predicted 1361
8 SASI_Rn01_00178944 predicted 298
9 SASI_Rn01_00178945 predicted 2113
10 SASI_Rn01_00178946 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306572 predicted 2088
2 SASI_Mm02_00306573 predicted 1756
3 SASI_Mm02_00306574 predicted 634
4 SASI_Mm02_00306575 predicted 491
5 SASI_Mm02_00306576 predicted 625
6 SASI_Mm02_00306577 predicted 2049
7 SASI_Mm02_00306578 predicted 2420
8 SASI_Mm02_00306579 predicted 2165
9 SASI_Mm02_00306580 predicted 982
10 SASI_Mm02_00306581 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021251 predicted 2089
2 SASI_Mm01_00021252 predicted 1757
3 SASI_Mm01_00021253 predicted 629
4 SASI_Mm02_00318369 predicted 494
5 SASI_Mm01_00021254 predicted 626
6 SASI_Mm01_00021255 predicted 2050
7 SASI_Mm01_00021256 predicted 2421
8 SASI_Mm01_00021257 predicted 2167
9 SASI_Mm01_00021258 predicted 981
10 SASI_Mm02_00318370 predicted 1804
11 SASI_Mm01_00021249 predicted 969
12 SASI_Mm01_00021250 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021956
GRIK2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-1793s1c1
Sequence:CCGGGCCCTTTATGACACTTGGAATCTCGAGATTCCAAGTGTCATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-414s1c1
Sequence:CCGGCCCAATACTACCCTTACCTATCTCGAGATAGGTAAGGGTAGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-257s1c1
Sequence:CCGGCCTGCTCTGTTTACTGTGGATCTCGAGATCCACAGTAAACAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-1486s1c1
Sequence:CCGGCCAATCGTTCTTTGATTGTTACTCGAGTAACAATCAAAGAACGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-2389s1c1
Sequence:CCGGCCTCTGATTATGCTTTCCTAACTCGAGTTAGGAAAGCATAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021956.4-1650s21c1
Sequence:CCGGCTCTATGGTAATGATCGATTTCTCGAGAAATCGATCATTACCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021956
GRIK2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-1793s1c1
Sequence:CCGGGCCCTTTATGACACTTGGAATCTCGAGATTCCAAGTGTCATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-414s1c1
Sequence:CCGGCCCAATACTACCCTTACCTATCTCGAGATAGGTAAGGGTAGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-257s1c1
Sequence:CCGGCCTGCTCTGTTTACTGTGGATCTCGAGATCCACAGTAAACAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-1486s1c1
Sequence:CCGGCCAATCGTTCTTTGATTGTTACTCGAGTAACAATCAAAGAACGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-2389s1c1
Sequence:CCGGCCTCTGATTATGCTTTCCTAACTCGAGTTAGGAAAGCATAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021956.4-1650s21c1
Sequence:CCGGCTCTATGGTAATGATCGATTTCTCGAGAAATCGATCATTACCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021956
GRIK2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-1793s1c1
Sequence:CCGGGCCCTTTATGACACTTGGAATCTCGAGATTCCAAGTGTCATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-414s1c1
Sequence:CCGGCCCAATACTACCCTTACCTATCTCGAGATAGGTAAGGGTAGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-257s1c1
Sequence:CCGGCCTGCTCTGTTTACTGTGGATCTCGAGATCCACAGTAAACAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-1486s1c1
Sequence:CCGGCCAATCGTTCTTTGATTGTTACTCGAGTAACAATCAAAGAACGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021956.2-2389s1c1
Sequence:CCGGCCTCTGATTATGCTTTCCTAACTCGAGTTAGGAAAGCATAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021956.4-1650s21c1
Sequence:CCGGCTCTATGGTAATGATCGATTTCTCGAGAAATCGATCATTACCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010349
GRIK2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010349.1-2905s1c1
Sequence:CCGGGTTATCAACATGCACACATTTCTCGAGAAATGTGTGCATGTTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-1743s1c1
Sequence:CCGGGCCGTTTATGACTCTTGGAATCTCGAGATTCCAAGAGTCATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-316s1c1
Sequence:CCGGGCATTCAGATTTGCTGTGAATCTCGAGATTCACAGCAAATCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-1745s1c1
Sequence:CCGGCGTTTATGACTCTTGGAATAACTCGAGTTATTCCAAGAGTCATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-2339s1c1
Sequence:CCGGCCTCCGATTATGCTTTCTTAACTCGAGTTAAGAAAGCATAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010349
GRIK2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010349.1-2905s1c1
Sequence:CCGGGTTATCAACATGCACACATTTCTCGAGAAATGTGTGCATGTTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-1743s1c1
Sequence:CCGGGCCGTTTATGACTCTTGGAATCTCGAGATTCCAAGAGTCATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-316s1c1
Sequence:CCGGGCATTCAGATTTGCTGTGAATCTCGAGATTCACAGCAAATCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-1745s1c1
Sequence:CCGGCGTTTATGACTCTTGGAATAACTCGAGTTATTCCAAGAGTCATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-2339s1c1
Sequence:CCGGCCTCCGATTATGCTTTCTTAACTCGAGTTAAGAAAGCATAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010349
GRIK2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010349.1-2905s1c1
Sequence:CCGGGTTATCAACATGCACACATTTCTCGAGAAATGTGTGCATGTTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-1743s1c1
Sequence:CCGGGCCGTTTATGACTCTTGGAATCTCGAGATTCCAAGAGTCATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-316s1c1
Sequence:CCGGGCATTCAGATTTGCTGTGAATCTCGAGATTCACAGCAAATCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-1745s1c1
Sequence:CCGGCGTTTATGACTCTTGGAATAACTCGAGTTATTCCAAGAGTCATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010349.1-2339s1c1
Sequence:CCGGCCTCCGATTATGCTTTCTTAACTCGAGTTAAGAAAGCATAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks