EMAIL THIS PAGE TO A FRIEND

GRIK3

glutamate receptor, ionotropic, kainate 3

114 Gene Product Result for
Synonyms: EAA5 GLR7 GLUR7 GluK3 GluR7a
UniProtKB ID: Q13003, B1AMS6, Q13004, Q16136
Gene ID:
Human(2899) Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. It is not certain if the subunit encoded by this gene is subject to RNA editing as the other 2 family members (GRIK1 and GRIK2). A Ser310Ala polymorphism has been associated with schizophrenia, and there are conflicting reports of its association with the pathogenesis of delirium tremens in alcoholics. [provided by RefSeq, Jul 2008]
Mouse(14807) glutamate receptor, ionotropic, kainate 3
Rat(298521) glutamate receptor, ionotropic, kainate 3
sheep(101114065) glutamate receptor, ionotropic, kainate 3
chicken(419619) glutamate receptor, ionotropic, kainate 3
dog(608269) glutamate receptor, ionotropic, kainate 3
cow(532553) glutamate receptor, ionotropic, kainate 3
domestic cat(101090033) glutamate receptor, ionotropic, kainate 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
K0250 Kainic acid monohydrate ≥99% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000831 Rosetta Predictions human pricing
NM_001112716 Rosetta Predictions rat pricing
NM_181373 Rosetta Predictions rat pricing
NM_001081097 Rosetta Predictions mouse pricing
XM_131647 Rosetta Predictions mouse pricing
XM_975859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095944 predicted 1961
2 SASI_Hs01_00095945 predicted 2147
3 SASI_Hs01_00095947 predicted 719
4 SASI_Hs01_00095948 predicted 836
5 SASI_Hs01_00095949 predicted 571
6 SASI_Hs01_00095950 predicted 1893
7 SASI_Hs01_00095951 predicted 373
8 SASI_Hs01_00095952 predicted 1114
9 SASI_Hs01_00095953 predicted 2403
10 SASI_Hs02_00303324 predicted 882
11 SASI_Hs01_00095946 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251610 predicted 2364
2 SASI_Rn02_00251611 predicted 566
3 SASI_Rn02_00251612 predicted 957
4 SASI_Rn02_00251613 predicted 383
5 SASI_Rn02_00251614 predicted 1120
6 SASI_Rn02_00251615 predicted 806
7 SASI_Rn02_00251616 predicted 715
8 SASI_Rn02_00251617 predicted 320
9 SASI_Rn02_00251618 predicted 1883
10 SASI_Rn02_00251619 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051043 predicted 2372
2 SASI_Rn01_00051044 predicted 569
3 SASI_Rn01_00051045 predicted 953
4 SASI_Rn02_00269705 predicted 379
5 SASI_Rn01_00051046 predicted 1113
6 SASI_Rn01_00051047 predicted 804
7 SASI_Rn01_00051048 predicted 712
8 SASI_Rn01_00051049 predicted 318
9 SASI_Rn01_00051050 predicted 1888
10 SASI_Rn01_00051051 predicted 882
11 SASI_Rn01_00051052 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295151 predicted 1578
2 SASI_Mm02_00295152 predicted 819
3 SASI_Mm02_00295153 predicted 253
4 SASI_Mm02_00295154 predicted 2194
5 SASI_Mm02_00295155 predicted 585
6 SASI_Mm02_00295156 predicted 229
7 SASI_Mm02_00295157 predicted 525
8 SASI_Mm02_00295158 predicted 972
9 SASI_Mm02_00295159 predicted 282
10 SASI_Mm02_00295160 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211974 predicted 1588
2 SASI_Mm01_00211975 predicted 828
3 SASI_Mm01_00211976 predicted 259
4 SASI_Mm01_00211977 predicted 2199
5 SASI_Mm01_00211978 predicted 591
6 SASI_Mm01_00211979 predicted 237
7 SASI_Mm01_00211980 predicted 528
8 SASI_Mm01_00211981 predicted 983
9 SASI_Mm01_00211982 predicted 287
10 SASI_Mm01_00211983 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207840 predicted 1581
2 SASI_Mm01_00207841 predicted 826
3 SASI_Mm01_00207842 predicted 257
4 SASI_Mm01_00207843 predicted 2191
5 SASI_Mm01_00207844 predicted 591
6 SASI_Mm01_00207845 predicted 230
7 SASI_Mm01_00207846 predicted 536
8 SASI_Mm01_00207847 predicted 973
9 SASI_Mm01_00207848 predicted 287
10 SASI_Mm01_00207849 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000831
GRIK3 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000831.3-1239s21c1
Sequence:CCGGGGCTCAATGGGAAGGATTAACCTCGAGGTTAATCCTTCCCATTGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000831.3-248s21c1
Sequence:CCGGTCGGAGGAATCTTCGAGTATGCTCGAGCATACTCGAAGATTCCTCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-1822s1c1
Sequence:CCGGCCAGACATCTGGATGTATGTTCTCGAGAACATACATCCAGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-662s1c1
Sequence:CCGGCCGTGGTCTATGACGACAGTACTCGAGTACTGTCGTCATAGACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-1418s1c1
Sequence:CCGGCCGACTCTCTGACAAACAGATCTCGAGATCTGTTTGTCAGAGAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-358s1c1
Sequence:CCGGCCCAACACAACCTTGACCTATCTCGAGATAGGTCAAGGTTGTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-981s1c1
Sequence:CCGGCCGGATTCTCAATGTGGACAACTCGAGTTGTCCACATTGAGAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000831
GRIK3 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000831.3-1239s21c1
Sequence:CCGGGGCTCAATGGGAAGGATTAACCTCGAGGTTAATCCTTCCCATTGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000831.3-248s21c1
Sequence:CCGGTCGGAGGAATCTTCGAGTATGCTCGAGCATACTCGAAGATTCCTCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-1822s1c1
Sequence:CCGGCCAGACATCTGGATGTATGTTCTCGAGAACATACATCCAGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-662s1c1
Sequence:CCGGCCGTGGTCTATGACGACAGTACTCGAGTACTGTCGTCATAGACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-1418s1c1
Sequence:CCGGCCGACTCTCTGACAAACAGATCTCGAGATCTGTTTGTCAGAGAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-358s1c1
Sequence:CCGGCCCAACACAACCTTGACCTATCTCGAGATAGGTCAAGGTTGTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-981s1c1
Sequence:CCGGCCGGATTCTCAATGTGGACAACTCGAGTTGTCCACATTGAGAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000831
GRIK3 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000831.3-1239s21c1
Sequence:CCGGGGCTCAATGGGAAGGATTAACCTCGAGGTTAATCCTTCCCATTGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000831.3-248s21c1
Sequence:CCGGTCGGAGGAATCTTCGAGTATGCTCGAGCATACTCGAAGATTCCTCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-1822s1c1
Sequence:CCGGCCAGACATCTGGATGTATGTTCTCGAGAACATACATCCAGATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-662s1c1
Sequence:CCGGCCGTGGTCTATGACGACAGTACTCGAGTACTGTCGTCATAGACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-1418s1c1
Sequence:CCGGCCGACTCTCTGACAAACAGATCTCGAGATCTGTTTGTCAGAGAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-358s1c1
Sequence:CCGGCCCAACACAACCTTGACCTATCTCGAGATAGGTCAAGGTTGTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000831.2-981s1c1
Sequence:CCGGCCGGATTCTCAATGTGGACAACTCGAGTTGTCCACATTGAGAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081097
GRIK3 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-1104s21c1
Sequence:CCGGGGCTCAATGGGAAGGATTAACCTCGAGGTTAATCCTTCCCATTGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-1895s21c1
Sequence:CCGGCTCTGTCTACCCGCATCATTGCTCGAGCAATGATGCGGGTAGACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-107s21c1
Sequence:CCGGTCCGGATCGGAGGAATCTTTGCTCGAGCAAAGATTCCTCCGATCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081097.2-4846s21c1
Sequence:CCGGTAATGGATGCAAGCGTGAATACTCGAGTATTCACGCTTGCATCCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081097
GRIK3 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-1104s21c1
Sequence:CCGGGGCTCAATGGGAAGGATTAACCTCGAGGTTAATCCTTCCCATTGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-1895s21c1
Sequence:CCGGCTCTGTCTACCCGCATCATTGCTCGAGCAATGATGCGGGTAGACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-107s21c1
Sequence:CCGGTCCGGATCGGAGGAATCTTTGCTCGAGCAAAGATTCCTCCGATCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081097.2-4846s21c1
Sequence:CCGGTAATGGATGCAAGCGTGAATACTCGAGTATTCACGCTTGCATCCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081097
GRIK3 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-1104s21c1
Sequence:CCGGGGCTCAATGGGAAGGATTAACCTCGAGGTTAATCCTTCCCATTGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-1895s21c1
Sequence:CCGGCTCTGTCTACCCGCATCATTGCTCGAGCAATGATGCGGGTAGACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081097.2-107s21c1
Sequence:CCGGTCCGGATCGGAGGAATCTTTGCTCGAGCAAAGATTCCTCCGATCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081097.2-4846s21c1
Sequence:CCGGTAATGGATGCAAGCGTGAATACTCGAGTATTCACGCTTGCATCCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)