EMAIL THIS PAGE TO A FRIEND

GRIK4

glutamate receptor, ionotropic, kainate 4

62 Gene Product Result for
Synonyms: EAA1 GRIK GluK4 KA1
UniProtKB ID: Q16099, A8K9L1
Gene ID:
Human(2900) Summary: This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. [provided by RefSeq, Jul 2008]
Mouse(110637) glutamate receptor, ionotropic, kainate 4
Rat(24406) glutamate receptor, ionotropic, kainate 4
Zebrafish(556582) glutamate receptor, ionotropic, kainate 4
chicken(419751) glutamate receptor, ionotropic, kainate 4
domestic cat(101085917) glutamate receptor, ionotropic, kainate 4
cow(526363) glutamate receptor, ionotropic, kainate 4
dog(610429) glutamate receptor, ionotropic, kainate 4
domestic guinea pig(100715810) glutamate receptor, ionotropic, kainate 4
naked mole-rat(101701636) glutamate receptor, ionotropic, kainate 4
sheep(101110444) glutamate receptor, ionotropic, kainate 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4391 Anti-Grik4 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4393 Anti-Grik4 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV13040 Anti-GRIK4 antibody produced in rabbit IgG fraction of antiserum canine, zebrafish, rabbit, rat, mouse, human, pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014619 Rosetta Predictions human pricing
NM_012572 Rosetta Predictions rat pricing
NM_175481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156060 predicted 1501
2 SASI_Hs01_00156061 predicted 328
3 SASI_Hs01_00156062 predicted 538
4 SASI_Hs01_00156063 predicted 706
5 SASI_Hs01_00156064 predicted 2280
6 SASI_Hs01_00156066 predicted 1560
7 SASI_Hs01_00156067 predicted 2172
8 SASI_Hs01_00156068 predicted 1543
9 SASI_Hs02_00345914 predicted 752
10 SASI_Hs02_00345915 predicted 715
11 SASI_Hs01_00156065 predicted 396
12 SASI_Hs01_00156069 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113821 predicted 2201
2 SASI_Rn01_00113822 predicted 789
3 SASI_Rn01_00113823 predicted 405
4 SASI_Rn01_00113824 predicted 2140
5 SASI_Rn01_00113825 predicted 606
6 SASI_Rn01_00113826 predicted 227
7 SASI_Rn01_00113827 predicted 1479
8 SASI_Rn01_00113828 predicted 1433
9 SASI_Rn01_00113829 predicted 2489
10 SASI_Rn01_00113830 predicted 1820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193881 predicted 1610
2 SASI_Mm01_00193882 predicted 1564
3 SASI_Mm01_00193883 predicted 1017
4 SASI_Mm01_00193884 predicted 2611
5 SASI_Mm01_00193885 predicted 1523
6 SASI_Mm01_00193887 predicted 343
7 SASI_Mm02_00346394 predicted 2460
8 SASI_Mm01_00193888 predicted 1948
9 SASI_Mm01_00193889 predicted 1330
10 SASI_Mm02_00346395 predicted 911
11 SASI_Mm01_00193880 predicted 1542
12 SASI_Mm01_00193886 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014619
GRIK4 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1988s1c1
Sequence:CCGGCCGCCATTGAATATGGCACAACTCGAGTTGTGCCATATTCAATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-2065s1c1
Sequence:CCGGCGCATGTGGAATTACATGTATCTCGAGATACATGTAATTCCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-393s1c1
Sequence:CCGGCCAGAGATTCACAACCCTGAACTCGAGTTCAGGGTTGTGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1374s1c1
Sequence:CCGGCCTCCGATTCAACTACAAGATCTCGAGATCTTGTAGTTGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1568s1c1
Sequence:CCGGGCATTCTTTACCGCGTTCATACTCGAGTATGAACGCGGTAAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-709s21c1
Sequence:CCGGGTGTCAGCCTATTACACATACCTCGAGGTATGTGTAATAGGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-188s21c1
Sequence:CCGGAGGTCGAAGTGGACATCTTTGCTCGAGCAAAGATGTCCACTTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-1059s21c1
Sequence:CCGGGGTAGAATTGGAAGGTCTTACCTCGAGGTAAGACCTTCCAATTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014619
GRIK4 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1988s1c1
Sequence:CCGGCCGCCATTGAATATGGCACAACTCGAGTTGTGCCATATTCAATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-2065s1c1
Sequence:CCGGCGCATGTGGAATTACATGTATCTCGAGATACATGTAATTCCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-393s1c1
Sequence:CCGGCCAGAGATTCACAACCCTGAACTCGAGTTCAGGGTTGTGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1374s1c1
Sequence:CCGGCCTCCGATTCAACTACAAGATCTCGAGATCTTGTAGTTGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1568s1c1
Sequence:CCGGGCATTCTTTACCGCGTTCATACTCGAGTATGAACGCGGTAAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-709s21c1
Sequence:CCGGGTGTCAGCCTATTACACATACCTCGAGGTATGTGTAATAGGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-188s21c1
Sequence:CCGGAGGTCGAAGTGGACATCTTTGCTCGAGCAAAGATGTCCACTTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-1059s21c1
Sequence:CCGGGGTAGAATTGGAAGGTCTTACCTCGAGGTAAGACCTTCCAATTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014619
GRIK4 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1988s1c1
Sequence:CCGGCCGCCATTGAATATGGCACAACTCGAGTTGTGCCATATTCAATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-2065s1c1
Sequence:CCGGCGCATGTGGAATTACATGTATCTCGAGATACATGTAATTCCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-393s1c1
Sequence:CCGGCCAGAGATTCACAACCCTGAACTCGAGTTCAGGGTTGTGAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1374s1c1
Sequence:CCGGCCTCCGATTCAACTACAAGATCTCGAGATCTTGTAGTTGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014619.2-1568s1c1
Sequence:CCGGGCATTCTTTACCGCGTTCATACTCGAGTATGAACGCGGTAAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-709s21c1
Sequence:CCGGGTGTCAGCCTATTACACATACCTCGAGGTATGTGTAATAGGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-188s21c1
Sequence:CCGGAGGTCGAAGTGGACATCTTTGCTCGAGCAAAGATGTCCACTTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014619.2-1059s21c1
Sequence:CCGGGGTAGAATTGGAAGGTCTTACCTCGAGGTAAGACCTTCCAATTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175481
GRIK4 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1120s1c1
Sequence:CCGGCTGCTGTTTGACGCTGTCTATCTCGAGATAGACAGCGTCAAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175481.2-3309s1c1
Sequence:CCGGCCTTTCCCTCACACTCAAATACTCGAGTATTTGAGTGTGAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1757s1c1
Sequence:CCGGCGCTGGGAATTAGTATTCTTTCTCGAGAAAGAATACTAATTCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1575s1c1
Sequence:CCGGCCTACGGTTCAACTACAAGATCTCGAGATCTTGTAGTTGAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-2191s1c1
Sequence:CCGGGCCATTGAGTATGGCACGATTCTCGAGAATCGTGCCATACTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-1718s21c1
Sequence:CCGGACGTGAGAAAGTGATCGATTTCTCGAGAAATCGATCACTTTCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-2620s21c1
Sequence:CCGGGAATCTTTGTGGTTCTTATTTCTCGAGAAATAAGAACCACAAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-979s21c1
Sequence:CCGGATGATAGAGTCAACATCTTAGCTCGAGCTAAGATGTTGACTCTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-903s21c1
Sequence:CCGGGGGATGGTGTCAGCCTATTACCTCGAGGTAATAGGCTGACACCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175481
GRIK4 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1120s1c1
Sequence:CCGGCTGCTGTTTGACGCTGTCTATCTCGAGATAGACAGCGTCAAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175481.2-3309s1c1
Sequence:CCGGCCTTTCCCTCACACTCAAATACTCGAGTATTTGAGTGTGAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1757s1c1
Sequence:CCGGCGCTGGGAATTAGTATTCTTTCTCGAGAAAGAATACTAATTCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1575s1c1
Sequence:CCGGCCTACGGTTCAACTACAAGATCTCGAGATCTTGTAGTTGAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-2191s1c1
Sequence:CCGGGCCATTGAGTATGGCACGATTCTCGAGAATCGTGCCATACTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-1718s21c1
Sequence:CCGGACGTGAGAAAGTGATCGATTTCTCGAGAAATCGATCACTTTCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-2620s21c1
Sequence:CCGGGAATCTTTGTGGTTCTTATTTCTCGAGAAATAAGAACCACAAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-979s21c1
Sequence:CCGGATGATAGAGTCAACATCTTAGCTCGAGCTAAGATGTTGACTCTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-903s21c1
Sequence:CCGGGGGATGGTGTCAGCCTATTACCTCGAGGTAATAGGCTGACACCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175481
GRIK4 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1120s1c1
Sequence:CCGGCTGCTGTTTGACGCTGTCTATCTCGAGATAGACAGCGTCAAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175481.2-3309s1c1
Sequence:CCGGCCTTTCCCTCACACTCAAATACTCGAGTATTTGAGTGTGAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1757s1c1
Sequence:CCGGCGCTGGGAATTAGTATTCTTTCTCGAGAAAGAATACTAATTCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-1575s1c1
Sequence:CCGGCCTACGGTTCAACTACAAGATCTCGAGATCTTGTAGTTGAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175481.2-2191s1c1
Sequence:CCGGGCCATTGAGTATGGCACGATTCTCGAGAATCGTGCCATACTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-1718s21c1
Sequence:CCGGACGTGAGAAAGTGATCGATTTCTCGAGAAATCGATCACTTTCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-2620s21c1
Sequence:CCGGGAATCTTTGTGGTTCTTATTTCTCGAGAAATAAGAACCACAAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-979s21c1
Sequence:CCGGATGATAGAGTCAACATCTTAGCTCGAGCTAAGATGTTGACTCTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175481.4-903s21c1
Sequence:CCGGGGGATGGTGTCAGCCTATTACCTCGAGGTAATAGGCTGACACCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks