EMAIL THIS PAGE TO A FRIEND

GRIK5

glutamate receptor, ionotropic, kainate 5

158 Gene Product Result for
Synonyms: EAA2 GRIK2 GluK5 KA2
UniProtKB ID: Q16478, Q8WWG8
Gene ID:
Human(2901) Summary: This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. [provided by RefSeq, Jul 2008]
Mouse(14809) glutamate receptor, ionotropic, kainate 5 (gamma 2)
Rat(24407) glutamate receptor, ionotropic, kainate 5
sheep(101103501) glutamate receptor, ionotropic, kainate 5
Domestic Rabbit(100356816) glutamate receptor, ionotropic, kainate 5
domestic guinea pig(100712717) glutamate receptor, ionotropic, kainate 5
naked mole-rat(101720804) glutamate receptor, ionotropic, kainate 5
Zebrafish(798791) glutamate receptor, ionotropic, kainate 5
dog(484480) glutamate receptor, ionotropic, kainate 5
Horse(100066235) glutamate receptor, ionotropic, kainate 5
cow(537698) glutamate receptor, ionotropic, kainate 5
domestic cat(101084407) glutamate receptor, ionotropic, kainate 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4397 Anti-Grik5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2100973 Anti-GRIK5 antibody produced in rabbit affinity isolated antibody , rabbit, zebrafish, bovine, mouse, canine, rat, guinea pig, human, horse
western blot pricing
SAB2106352 Anti-GRIK5 antibody produced in rabbit affinity isolated antibody human, rabbit, horse, mouse, guinea pig
ELISA, western blot pricing
SAB2900753 Anti-GRIK5 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
G2128 L-Glutamic acid hydrochloride ≥99% (HPLC) human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
K0250 Kainic acid monohydrate ≥99% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002088 Rosetta Predictions human pricing
NM_017262 Rosetta Predictions rat pricing
NM_031508 Rosetta Predictions rat pricing
NM_008168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184942 predicted 1733
2 SASI_Hs01_00184943 predicted 2010
3 SASI_Hs01_00184944 predicted 1196
4 SASI_Hs01_00184945 predicted 929
5 SASI_Hs01_00184947 predicted 595
6 SASI_Hs01_00184948 predicted 250
7 SASI_Hs01_00184949 predicted 784
8 SASI_Hs02_00333175 predicted 1696
9 SASI_Hs01_00184950 predicted 2102
10 SASI_Hs01_00184951 predicted 409
11 SASI_Hs01_00184946 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114898 predicted 838
2 SASI_Rn02_00261659 predicted 421
3 SASI_Rn01_00114899 predicted 2407
4 SASI_Rn01_00114900 predicted 2075
5 SASI_Rn01_00114901 predicted 631
6 SASI_Rn01_00114902 predicted 236
7 SASI_Rn01_00114903 predicted 1218
8 SASI_Rn01_00114904 predicted 1760
9 SASI_Rn01_00114906 predicted 985
10 SASI_Rn01_00114907 predicted 1453
11 SASI_Rn01_00114905 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051931 predicted 1036
2 SASI_Rn02_00264633 predicted 608
3 SASI_Rn01_00051932 predicted 2604
4 SASI_Rn01_00051933 predicted 2269
5 SASI_Rn01_00051934 predicted 819
6 SASI_Rn01_00051935 predicted 425
7 SASI_Rn01_00051936 predicted 1413
8 SASI_Rn01_00051937 predicted 1943
9 SASI_Rn01_00051939 predicted 1172
10 SASI_Rn01_00051940 predicted 1644
11 SASI_Rn01_00051938 predicted 2348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050739 predicted 401
2 SASI_Mm02_00313284 predicted 1207
3 SASI_Mm01_00050740 predicted 2445
4 SASI_Mm02_00313285 predicted 1017
5 SASI_Mm01_00050741 predicted 1206
6 SASI_Mm01_00050743 predicted 997
7 SASI_Mm01_00050744 predicted 1408
8 SASI_Mm01_00050745 predicted 1587
9 SASI_Mm01_00050746 predicted 830
10 SASI_Mm01_00050747 predicted 2124
11 SASI_Mm01_00050742 predicted 1352
12 SASI_Mm01_00050748 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002088
GRIK5 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-2406s21c1
Sequence:CCGGGAGGAGGACCATCGAGCTAAACTCGAGTTTAGCTCGATGGTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-1085s21c1
Sequence:CCGGGCGCATGGTAGAGTATGATGGCTCGAGCCATCATACTCTACCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-2428s21c1
Sequence:CCGGGTTTGGGCATGGAGAACATTGCTCGAGCAATGTTCTCCATGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2198s1c1
Sequence:CCGGCGAGTCCACCATGAACGAATACTCGAGTATTCGTTCATGGTGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-219s1c1
Sequence:CCGGCGAGTGGAAGTAGACATCTTTCTCGAGAAAGATGTCTACTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-353s1c1
Sequence:CCGGGAGCCATATCTGTGGAGAGAACTCGAGTTCTCTCCACAGATATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2496s1c1
Sequence:CCGGGTGGCGGTCATGGAATTCATACTCGAGTATGAATTCCATGACCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2013s1c1
Sequence:CCGGGATCAGACCAACATCGAGTATCTCGAGATACTCGATGTTGGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002088
GRIK5 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-2406s21c1
Sequence:CCGGGAGGAGGACCATCGAGCTAAACTCGAGTTTAGCTCGATGGTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-1085s21c1
Sequence:CCGGGCGCATGGTAGAGTATGATGGCTCGAGCCATCATACTCTACCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-2428s21c1
Sequence:CCGGGTTTGGGCATGGAGAACATTGCTCGAGCAATGTTCTCCATGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2198s1c1
Sequence:CCGGCGAGTCCACCATGAACGAATACTCGAGTATTCGTTCATGGTGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-219s1c1
Sequence:CCGGCGAGTGGAAGTAGACATCTTTCTCGAGAAAGATGTCTACTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-353s1c1
Sequence:CCGGGAGCCATATCTGTGGAGAGAACTCGAGTTCTCTCCACAGATATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2496s1c1
Sequence:CCGGGTGGCGGTCATGGAATTCATACTCGAGTATGAATTCCATGACCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2013s1c1
Sequence:CCGGGATCAGACCAACATCGAGTATCTCGAGATACTCGATGTTGGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002088
GRIK5 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-2406s21c1
Sequence:CCGGGAGGAGGACCATCGAGCTAAACTCGAGTTTAGCTCGATGGTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-1085s21c1
Sequence:CCGGGCGCATGGTAGAGTATGATGGCTCGAGCCATCATACTCTACCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002088.3-2428s21c1
Sequence:CCGGGTTTGGGCATGGAGAACATTGCTCGAGCAATGTTCTCCATGCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2198s1c1
Sequence:CCGGCGAGTCCACCATGAACGAATACTCGAGTATTCGTTCATGGTGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-219s1c1
Sequence:CCGGCGAGTGGAAGTAGACATCTTTCTCGAGAAAGATGTCTACTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-353s1c1
Sequence:CCGGGAGCCATATCTGTGGAGAGAACTCGAGTTCTCTCCACAGATATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2496s1c1
Sequence:CCGGGTGGCGGTCATGGAATTCATACTCGAGTATGAATTCCATGACCGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002088.3-2013s1c1
Sequence:CCGGGATCAGACCAACATCGAGTATCTCGAGATACTCGATGTTGGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008168
GRIK5 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, kainate 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008168.1-3327s1c1
Sequence:CCGGGCCTTCAATTCCTGGTGAAGTCTCGAGACTTCACCAGGAATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1575s1c1
Sequence:CCGGCCTGGAGAACCCGTATGTTATCTCGAGATAACATACGGGTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1005s1c1
Sequence:CCGGGCTGGGAATGACCTCAGCGTTCTCGAGAACGCTGAGGTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1574s1c1
Sequence:CCGGTCCTGGAGAACCCGTATGTTACTCGAGTAACATACGGGTTCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-2294s1c1
Sequence:CCGGCCAACATTGAGTACGGCACTACTCGAGTAGTGCCGTACTCAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008168
GRIK5 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, kainate 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008168.1-3327s1c1
Sequence:CCGGGCCTTCAATTCCTGGTGAAGTCTCGAGACTTCACCAGGAATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1575s1c1
Sequence:CCGGCCTGGAGAACCCGTATGTTATCTCGAGATAACATACGGGTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1005s1c1
Sequence:CCGGGCTGGGAATGACCTCAGCGTTCTCGAGAACGCTGAGGTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1574s1c1
Sequence:CCGGTCCTGGAGAACCCGTATGTTACTCGAGTAACATACGGGTTCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-2294s1c1
Sequence:CCGGCCAACATTGAGTACGGCACTACTCGAGTAGTGCCGTACTCAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008168
GRIK5 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, kainate 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008168.1-3327s1c1
Sequence:CCGGGCCTTCAATTCCTGGTGAAGTCTCGAGACTTCACCAGGAATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1575s1c1
Sequence:CCGGCCTGGAGAACCCGTATGTTATCTCGAGATAACATACGGGTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1005s1c1
Sequence:CCGGGCTGGGAATGACCTCAGCGTTCTCGAGAACGCTGAGGTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-1574s1c1
Sequence:CCGGTCCTGGAGAACCCGTATGTTACTCGAGTAACATACGGGTTCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008168.1-2294s1c1
Sequence:CCGGCCAACATTGAGTACGGCACTACTCGAGTAGTGCCGTACTCAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks