EMAIL THIS PAGE TO A FRIEND

GRIN1

glutamate receptor, ionotropic, N-methyl D-aspartate 1

151 Gene Product Result for
Synonyms: GluN1 MRD8 NMDA1 NMDAR1 NR1
Gene ID:
Human(2902) Summary: The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Mouse(14810) glutamate receptor, ionotropic, NMDA1 (zeta 1)
Rat(24408) glutamate receptor, ionotropic, N-methyl D-aspartate 1
chicken(404296) glutamate receptor, ionotropic, N-methyl D-aspartate 1
dog(494007) glutamate receptor, ionotropic, N-methyl D-aspartate 1
Horse(100059861) glutamate receptor, ionotropic, N-methyl D-aspartate 1
cow(100336579) glutamate receptor, ionotropic, N-methyl D-aspartate 1
domestic guinea pig(100301989) glutamate receptor, ionotropic, NMDA1 (zeta 1)
naked mole-rat(101720185) glutamate receptor, ionotropic, N-methyl D-aspartate 1
sheep(443281) glutamate receptor, ionotropic, N-methyl D-aspartate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G0166 Anti-Glutamate Receptor NMDAR1 (NR1) (Splice Variant Insert C1) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, mouse
immunohistochemistry, western blot pricing
G0416 Anti-Glutamate Receptor NMDAR1 (NR1) (Splice Variant Insert C2′) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat
immunoprecipitation, western blot pricing
G0291 Anti-Glutamate Receptor NMDAR1 (NR1) (Splice Variant Insert C2) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, mouse
immunohistochemistry, western blot pricing
G0541 Anti-Glutamate Receptor NMDAR1 (NR1) (Splice Variant Insert N1) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
dot blot, immunohistochemistry, western blot pricing
G8913 Anti-Glutamate Receptor NMDAR1 (NR1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB4300405 Anti-GRIN1 (Ab-896) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4300538 Anti-GRIN1 (Ab-897) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence pricing
SAB2500698 Anti-NMDA Receptor 1/GRIN1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB4501301 Anti-NMDAR1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501302 Anti-NMDAR1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4501303 Anti-NMDAR1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300083 Anti-phospho-GRIN1 (pSer896) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4504045 Anti-phospho-NMDAR1 (pSer890) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4301246 Anti-phospho-NMDAR1 (pSer890) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry pricing
SAB4301476 Anti-phospho-NMDAR1 (pSer890) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504046 Anti-phospho-NMDAR1 (pSer896) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504493 Anti-phospho-NMDAR1 (pSer897) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5200555 Monoclonal Anti-Glun1-Nr1 - Alkaline Phosphatase antibody produced in mouse clone S308-48, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200556 Monoclonal Anti-Glun1-Nr1 - Apc antibody produced in mouse clone S308-48, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200547 Monoclonal Anti-Glun1-Nr1 - Atto 390 antibody produced in mouse clone S308-48, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200548 Monoclonal Anti-Glun1-Nr1 - Atto 488 antibody produced in mouse clone S308-48, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200549 Monoclonal Anti-Glun1-Nr1 - Atto 565 antibody produced in mouse clone S308-48, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200550 Monoclonal Anti-Glun1-Nr1 - Atto 594 antibody produced in mouse clone S308-48, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200551 Monoclonal Anti-Glun1-Nr1 - Atto 633 antibody produced in mouse clone S308-48, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200552 Monoclonal Anti-Glun1-Nr1 - Atto 655 antibody produced in mouse clone S308-48, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200553 Monoclonal Anti-Glun1-Nr1 - Atto 680 antibody produced in mouse clone S308-48, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200554 Monoclonal Anti-Glun1-Nr1 - Atto 700 antibody produced in mouse clone S308-48, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200557 Monoclonal Anti-Glun1-Nr1 - Biotin antibody produced in mouse clone S308-48, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200558 Monoclonal Anti-Glun1-Nr1 - Fitc antibody produced in mouse clone S308-48, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200559 Monoclonal Anti-Glun1-Nr1 - Hrp antibody produced in mouse clone S308-48, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200560 Monoclonal Anti-Glun1-Nr1 - Pe/Atto 594 antibody produced in mouse clone S308-48, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200561 Monoclonal Anti-Glun1-Nr1 - Percp antibody produced in mouse clone S308-48, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200562 Monoclonal Anti-Glun1-Nr1 - Rpe antibody produced in mouse clone S308-48, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200563 Monoclonal Anti-Glun1-Nr1 - Streptavidin antibody produced in mouse clone S308-48, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200546 Monoclonal Anti-Glun1-Nr1 antibody produced in mouse clone S308-48, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
N2034 CR 2249 human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB1586 Anti-NMDAR1 Antibody, (all splice variants), clone R1JHL Detect NMDAR1 using this Anti-NMDAR1 Antibody, (all splice variants), clone R1JHL validated for use in WB. pricing
AB9864R Anti-NMDAR1 Antibody, clone 1.17.2.6, rabbit monoclonal Anti-NMDAR1 Antibody, clone 1.17.2.6 detects level of NMDAR1 & has been published & validated for use in WB, IH. pricing
MAB363 Anti-NMDAR1 Antibody, clone 54.1 Anti-NMDAR1 Antibody, clone 54.1 is an antibody against NMDAR1 for use in ELISA, IC, IH, IH(P), RIA. pricing
MAB1570 Anti-NMDAR1 Antibody, CT, C2 cassette, clone 2C6.2 Anti-NMDAR1 Antibody, C-terminus, C2 cassette, clone 2C6.2 is an antibody against NMDAR1 for use in IH & WB. pricing
AB9864 Anti-NMDAR1 Antibody, rabbit monoclonal This Anti-NMDAR1 Antibody is validated for use in IH, WB for the detection of NMDAR1. pricing
AB5046P Anti-NMDAR1 Splice Variant C1 Antibody Anti-NMDAR1 Splice Variant C1 Antibody is an antibody against NMDAR1 Splice Variant C1 for use in WB. pricing
AB5048P Anti-NMDAR1 Splice Variant C2 Antibody This Anti-NMDAR1 Splice Variant C2 Antibody is validated for use in IH, WB for the detection of NMDAR1 Splice Variant C2. pricing
AB5050P Anti-NMDAR1 Splice Variant C2 Antibody Detect NMDAR1 Splice Variant C2 using this Anti-NMDAR1 Splice Variant C2 Antibody validated for use in IH & WB. pricing
05-432A4 Anti-NR1 Antibody, C Terminus, Alexa Fluor®488 Conjugate | 05-432A4 pricing
05-432 Anti-NR1 Antibody, CT Anti-NR1 Antibody, CT detects level of NR1 & has been published & validated for use in IC, IP & WB. pricing
ABN88 Anti-phospho-NR1 (Ser896) Antibody Detect phospho-NR1 (Ser896) using this Anti-phospho-NR1 (Ser896) Antibody validated for use in WB, IH(P). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000832 Rosetta Predictions human pricing
NM_007327 Rosetta Predictions human pricing
NM_021569 Rosetta Predictions human pricing
NM_017010 Rosetta Predictions rat pricing
NM_008169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049075 predicted 1940
2 SASI_Hs01_00049076 predicted 1369
3 SASI_Hs01_00049077 predicted 779
4 SASI_Hs02_00303325 predicted 2430
5 SASI_Hs01_00049079 predicted 2692
6 SASI_Hs01_00049080 predicted 1598
7 SASI_Hs01_00049081 predicted 504
8 SASI_Hs01_00049082 predicted 661
9 SASI_Hs01_00049083 predicted 1515
10 SASI_Hs01_00049084 predicted 1506
11 SASI_Hs01_00049078 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011688 predicted 1933
2 SASI_Hs01_00011689 predicted 1370
3 SASI_Hs01_00011690 predicted 778
4 SASI_Hs02_00343404 predicted 2422
5 SASI_Hs01_00011692 predicted 2692
6 SASI_Hs01_00011693 predicted 1603
7 SASI_Hs01_00011694 predicted 500
8 SASI_Hs01_00011695 predicted 664
9 SASI_Hs01_00011696 predicted 1514
10 SASI_Hs01_00011697 predicted 1502
11 SASI_Hs01_00011691 predicted 2247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018624 predicted 1940
2 SASI_Hs01_00018625 predicted 1366
3 SASI_Hs01_00018626 predicted 778
4 SASI_Hs02_00354929 predicted 2429
5 SASI_Hs01_00018628 predicted 2685
6 SASI_Hs01_00018629 predicted 1602
7 SASI_Hs01_00018630 predicted 507
8 SASI_Hs01_00018631 predicted 659
9 SASI_Hs01_00018632 predicted 1517
10 SASI_Hs01_00018633 predicted 1504
11 SASI_Hs01_00018627 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034432 predicted 641
2 SASI_Rn01_00034433 predicted 730
3 SASI_Rn01_00034434 predicted 707
4 SASI_Rn01_00034435 predicted 2571
5 SASI_Rn01_00034437 predicted 2286
6 SASI_Rn01_00034438 predicted 1352
7 SASI_Rn01_00034439 predicted 1448
8 SASI_Rn01_00034440 predicted 409
9 SASI_Rn01_00034441 predicted 1436
10 SASI_Rn02_00261174 predicted 394
11 SASI_Rn01_00034436 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086832 predicted 1303
2 SASI_Mm01_00086833 predicted 2117
3 SASI_Mm01_00086835 predicted 1179
4 SASI_Mm01_00086836 predicted 1280
5 SASI_Mm01_00086837 predicted 234
6 SASI_Mm01_00086839 predicted 217
7 SASI_Mm01_00086840 predicted 2476
8 SASI_Mm01_00086841 predicted 543
9 SASI_Mm02_00313286 predicted 2190
10 SASI_Mm02_00313287 predicted 1850
11 SASI_Mm01_00086834 predicted 1142
12 SASI_Mm01_00086838 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000832
GRIN1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2704s1c1
Sequence:CCGGCCTGACTATTCTGGTCAAGAACTCGAGTTCTTGACCAGAATAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2212s1c1
Sequence:CCGGCCCTAATGACAGGAAGATCATCTCGAGATGATCTTCCTGTCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2137s1c1
Sequence:CCGGCGCCAACTACAGCATCATGAACTCGAGTTCATGATGCTGTAGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-3682s1c1
Sequence:CCGGGCAGTACCATCCCACTGATATCTCGAGATATCAGTGGGATGGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-1546s1c1
Sequence:CCGGGTTTGAGATGATGCGTGTCTACTCGAGTAGACACGCATCATCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000832.5-1415s21c1
Sequence:CCGGTGCAAGTGGGCATCTACAATGCTCGAGCATTGTAGATGCCCACTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000832.5-2696s21c1
Sequence:CCGGACAAGACGTGGGTTCGGTATCCTCGAGGATACCGAACCCACGTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000832
GRIN1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2704s1c1
Sequence:CCGGCCTGACTATTCTGGTCAAGAACTCGAGTTCTTGACCAGAATAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2212s1c1
Sequence:CCGGCCCTAATGACAGGAAGATCATCTCGAGATGATCTTCCTGTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2137s1c1
Sequence:CCGGCGCCAACTACAGCATCATGAACTCGAGTTCATGATGCTGTAGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-3682s1c1
Sequence:CCGGGCAGTACCATCCCACTGATATCTCGAGATATCAGTGGGATGGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-1546s1c1
Sequence:CCGGGTTTGAGATGATGCGTGTCTACTCGAGTAGACACGCATCATCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000832.5-1415s21c1
Sequence:CCGGTGCAAGTGGGCATCTACAATGCTCGAGCATTGTAGATGCCCACTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000832.5-2696s21c1
Sequence:CCGGACAAGACGTGGGTTCGGTATCCTCGAGGATACCGAACCCACGTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000832
GRIN1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2704s1c1
Sequence:CCGGCCTGACTATTCTGGTCAAGAACTCGAGTTCTTGACCAGAATAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2212s1c1
Sequence:CCGGCCCTAATGACAGGAAGATCATCTCGAGATGATCTTCCTGTCATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-2137s1c1
Sequence:CCGGCGCCAACTACAGCATCATGAACTCGAGTTCATGATGCTGTAGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-3682s1c1
Sequence:CCGGGCAGTACCATCCCACTGATATCTCGAGATATCAGTGGGATGGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000832.4-1546s1c1
Sequence:CCGGGTTTGAGATGATGCGTGTCTACTCGAGTAGACACGCATCATCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000832.5-1415s21c1
Sequence:CCGGTGCAAGTGGGCATCTACAATGCTCGAGCATTGTAGATGCCCACTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000832.5-2696s21c1
Sequence:CCGGACAAGACGTGGGTTCGGTATCCTCGAGGATACCGAACCCACGTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008169
GRIN1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-561s1c1
Sequence:CCGGCGTCTACAACTGGAACCATATCTCGAGATATGGTTCCAGTTGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1212s1c1
Sequence:CCGGCCCAAATGACAGGAAGATCATCTCGAGATGATCTTCCTGTCATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1277s1c1
Sequence:CCGGCCACCAGACTAAAGATAGTGACTCGAGTCACTATCTTTAGTCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1317s1c1
Sequence:CCGGCGTGTATGTCAAGCCCACAATCTCGAGATTGTGGGCTTGACATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-2413s1c1
Sequence:CCGGCTGTCCATACTCAAGTCCCATCTCGAGATGGGACTTGAGTATGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-351s21c1
Sequence:CCGGGGTCTACGCTATCCTAGTTAGCTCGAGCTAACTAGGATAGCGTAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1633s21c1
Sequence:CCGGGTGGCTCCACTGACCATTAACCTCGAGGTTAATGGTCAGTGGAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1128s21c1
Sequence:CCGGCCGGAAGTTTGCCAACTATAGCTCGAGCTATAGTTGGCAAACTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1842s21c1
Sequence:CCGGCAGTCCCTTTGGCCGATTTAACTCGAGTTAAATCGGCCAAAGGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-2078s21c1
Sequence:CCGGAGCGCATCACAGGCATCAATGCTCGAGCATTGATGCCTGTGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008169
GRIN1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-561s1c1
Sequence:CCGGCGTCTACAACTGGAACCATATCTCGAGATATGGTTCCAGTTGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1212s1c1
Sequence:CCGGCCCAAATGACAGGAAGATCATCTCGAGATGATCTTCCTGTCATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1277s1c1
Sequence:CCGGCCACCAGACTAAAGATAGTGACTCGAGTCACTATCTTTAGTCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1317s1c1
Sequence:CCGGCGTGTATGTCAAGCCCACAATCTCGAGATTGTGGGCTTGACATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-2413s1c1
Sequence:CCGGCTGTCCATACTCAAGTCCCATCTCGAGATGGGACTTGAGTATGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-351s21c1
Sequence:CCGGGGTCTACGCTATCCTAGTTAGCTCGAGCTAACTAGGATAGCGTAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1633s21c1
Sequence:CCGGGTGGCTCCACTGACCATTAACCTCGAGGTTAATGGTCAGTGGAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1128s21c1
Sequence:CCGGCCGGAAGTTTGCCAACTATAGCTCGAGCTATAGTTGGCAAACTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1842s21c1
Sequence:CCGGCAGTCCCTTTGGCCGATTTAACTCGAGTTAAATCGGCCAAAGGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-2078s21c1
Sequence:CCGGAGCGCATCACAGGCATCAATGCTCGAGCATTGATGCCTGTGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008169
GRIN1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-561s1c1
Sequence:CCGGCGTCTACAACTGGAACCATATCTCGAGATATGGTTCCAGTTGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1212s1c1
Sequence:CCGGCCCAAATGACAGGAAGATCATCTCGAGATGATCTTCCTGTCATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1277s1c1
Sequence:CCGGCCACCAGACTAAAGATAGTGACTCGAGTCACTATCTTTAGTCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-1317s1c1
Sequence:CCGGCGTGTATGTCAAGCCCACAATCTCGAGATTGTGGGCTTGACATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008169.1-2413s1c1
Sequence:CCGGCTGTCCATACTCAAGTCCCATCTCGAGATGGGACTTGAGTATGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-351s21c1
Sequence:CCGGGGTCTACGCTATCCTAGTTAGCTCGAGCTAACTAGGATAGCGTAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1633s21c1
Sequence:CCGGGTGGCTCCACTGACCATTAACCTCGAGGTTAATGGTCAGTGGAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1128s21c1
Sequence:CCGGCCGGAAGTTTGCCAACTATAGCTCGAGCTATAGTTGGCAAACTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-1842s21c1
Sequence:CCGGCAGTCCCTTTGGCCGATTTAACTCGAGTTAAATCGGCCAAAGGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008169.1-2078s21c1
Sequence:CCGGAGCGCATCACAGGCATCAATGCTCGAGCATTGATGCCTGTGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)