EMAIL THIS PAGE TO A FRIEND

GRIN2B

glutamate receptor, ionotropic, N-methyl D-aspartate 2B

Synonyms: GluN2B MRD6 NMDAR2B NR2B hNR3
UniProtKB ID: Q13224, Q12919, Q13220, Q13225, Q14CU4, Q9UM56
Gene ID:
Human(2904) Summary: N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
Mouse(14812) glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Rat(24410) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
chicken(417965) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
dog(494009) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
domestic cat(101094356) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Horse(100063746) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
cow(537804) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
domestic guinea pig(100731840) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
naked mole-rat(101723091) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
sheep(101118179) glutamate receptor, ionotropic, N-methyl D-aspartate 2B
161 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M265 Anti-Glutamate Receptor NMDAR2B (NR2B) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB4300425 Anti-GRIN2B (Ab-1474) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence pricing
SAB2104208 Anti-GRIN2B antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, mouse, canine, human, horse
western blot pricing
HPA069762 Anti-GRIN2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4300711 Anti-NMDANR2B antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4501305 Anti-NMDAR2B, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4501306 Anti-NMDAR2B, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB2500699 Anti-NMDAR2B/GRIN2B antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, canine, mouse
ELISA, western blot pricing
SAB4504753 Anti-phospho-GRIN2B (pSer1303) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301378 Anti-phospho-GRIN2B (pSer1303) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300138 Anti-phospho-GRIN2B (pTyr1474) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence pricing
M2442 Anti-phospho-N-Methyl D-Aspartate NR2B Subunit (pTyr1472) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, chicken, Xenopus, rat
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB4504677 Anti-phospho-NMDAR2B (pTyr1336) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301457 Anti-phospho-NMDAR2B (pTyr1336) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4503950 Anti-phospho-NMDAR2B (pTyr1474) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB1402214 Monoclonal Anti-GRIN2B antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A0384 Arcaine sulfate salt human pricing
D2531 Dextromethorphan hydrobromide monohydrate ≥99% (TLC) human pricing
D127 Dextrorphan tartrate powder human pricing
F0778 Felbamate human pricing
I2892 Ifenprodil (+)-tartrate salt human pricing
R7150 Ro 25-6981 hydrochloride hydrate ≥98% (HPLC), powder human pricing
R8900 Ro 8-4304 solid human pricing
M107 (+)-MK-801 hydrogen maleate powder human, mouse, rat pricing
A0326 (S)-AMPA ≥98% human, mouse, rat pricing
D138 5,7-Dichlorokynurenic acid monohydrate solid, ≥98% (HPLC) human, mouse, rat pricing
N179 NS 102 solid human, mouse, rat pricing
A1910 (±)-2-Amino-4-phosphonobutyric acid solid human, rat pricing
C104 (±)-CPP solid human, rat pricing
M5435 6-Methyl-2-(phenylethynyl)pyridine hydrochloride ≥98% (HPLC) human, rat pricing
A5157 DL-2-Amino-7-phosphonoheptanoic acid ~95% human, rat pricing
E2031 Eliprodil ≥98% (HPLC), powder human, rat pricing
G5667 L-Glutamic acid PharmaGrade, Ajinomoto, EP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
W328502 L-Glutamic acid 99%, FCC human, rat pricing
G8415 L-Glutamic acid from non-animal source, meets EP testing specifications, suitable for cell culture, 98.5-100.5% human, rat pricing
49449 L-Glutamic acid BioUltra, ≥99.5% (NT) human, rat pricing
G1251 L-Glutamic acid ReagentPlus®, ≥99% (HPLC) human, rat pricing
09581 L-Glutamic acid tested according to Ph.Eur. human, rat pricing
S4264 Spermine amorphous semi-solid, BioReagent, suitable for cell culture human, rat pricing
S3256 Spermine ≥97% human, rat pricing
85588 Spermine dihydrate BioUltra, ≥99.5% (GC) human, rat pricing
A8054 D(−)-2-Amino-5-phosphonopentanoic acid NMDA receptor antagonist mouse, rat pricing
299650 2-Phenylquinoline 99% rat pricing
A5282 DL-2-Amino-5-phosphonopentanoic acid solid rat pricing
A6553 DL-2-Amino-5-phosphonovaleric acid lithium salt ~95% rat pricing
A0637 DL-2-Aminoadipic acid ≥99% rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067251 MISSION® esiRNA esiRNA targeting mouse Grin2b (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB15362 Anti-NMDAR2B Antibody 100 µg, This Anti-NMDAR2B Antibody is validated for use in WB for the detection of NMDAR2B. pricing
AB1557P Anti-NMDAR2B Antibody 10 µg, Anti-NMDAR2B Antibody is an antibody against NMDAR2B for use in IH, IP & WB. pricing
MAB5574 Anti-NMDAR2B Antibody 100 µL, Detect NMDAR2B using this Anti-NMDAR2B Antibody validated for use in WB. pricing
MAB5780 Anti-NMDAR2B Antibody 100 µL, Anti-NMDAR2B Antibody detects level of NMDAR2B & has been published & validated for use in WB. pricing
MAB5220 Anti-NMDAR2B Antibody, clone 13A11 100 µg, Anti-NMDAR2B Antibody, clone 13A11 is an antibody against NMDAR2B for use in IC, IH & WB. pricing
MAB5778 Anti-NMDAR2B Antibody, CT 100 µL, This Anti-NMDAR2B Antibody, C-terminal is validated for use in WB for the detection of NMDAR2B. pricing
MAB5782 Anti-NMDAR2B Antibody, NT 100 µL, Detect NMDAR2B using this Anti-NMDAR2B Antibody, N-terminal validated for use in WB. pricing
AB1557 Anti-NMDAR2B Antibody, pain 50 µL, Anti-NMDAR2B Antibody, pain detects level of NMDAR2B & has been published & validated for use in IP & WB. pricing
AB5403 Anti-NMDAR2B Antibody, phosphoTyr 1472 100 µL, Anti-NMDAR2B Antibody, phosphoTyr 1472 is an antibody against NMDAR2B for use in WB. pricing
AB9630 Anti-NMDAR2B phospho Tyr1252 Antibody 100 µL, Anti-NMDAR2B phospho Tyr1252 Antibody is an antibody against NMDAR2B phospho Tyr1252 for use in WB. pricing
AB9690 Anti-NMDAR2B phospho Tyrosine 1336 Antibody 100 µL, Detect NMDAR2B phospho Tyrosine 1336 using this Anti-NMDAR2B phospho Tyrosine 1336 Antibody validated for use in WB. pricing
06-600 Anti-NR2B Antibody 250 µg, Detect NR2B using this Anti-NR2B Antibody validated for use in IC, IP & WB. pricing
05-920 Anti-NR2B Antibody, clone BWJHL 100 µg, Anti-NR2B Antibody, clone BWJHL detects level of NR2B & has been published & validated for use in WB. pricing
07-398 Anti-phospho-NR2B (Ser1303) Antibody 200 µg, Anti-phospho-NR2B (Ser1303) Antibody detects level of phospho-NR2B (Ser1303) & has been published & validated for use in WB. pricing
FCABS332F Milli-Mark™ Anti-NR2B-FITC Antibody 100 tests, Milli-Mark Anti-NR2B-FITC Antibody detects level of NR2B & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000834 Rosetta Predictions human pricing
NM_012574 Rosetta Predictions rat pricing
NM_008171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176740 predicted 3050
2 SASI_Hs01_00176741 predicted 609
3 SASI_Hs01_00176742 predicted 1173
4 SASI_Hs01_00176744 predicted 1600
5 SASI_Hs01_00176743 predicted 3653
6 SASI_Hs01_00176745 predicted 436
7 SASI_Hs01_00176746 predicted 1595
8 SASI_Hs01_00176749 predicted 1159
9 SASI_Hs02_00303329 predicted 1965
10 SASI_Hs02_00303330 predicted 3306
11 SASI_Hs01_00176747 predicted 774
12 SASI_Hs01_00176748 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055296 predicted 4086
2 SASI_Rn02_00259700 predicted 2735
3 SASI_Rn01_00055297 predicted 2428
4 SASI_Rn01_00055298 predicted 1339
5 SASI_Rn01_00055299 predicted 1330
6 SASI_Rn01_00055301 predicted 4217
7 SASI_Rn01_00055302 predicted 3338
8 SASI_Rn01_00055304 predicted 4074
9 SASI_Rn01_00055305 predicted 3595
10 SASI_Rn02_00259701 predicted 1482
11 SASI_Rn01_00055300 predicted 1956
12 SASI_Rn01_00055303 predicted 2617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313292 predicted 2270
2 SASI_Mm01_00185017 predicted 1755
3 SASI_Mm01_00185020 predicted 4210
4 SASI_Mm01_00185018 predicted 3585
5 SASI_Mm02_00313293 predicted 3911
6 SASI_Mm01_00185021 predicted 3368
7 SASI_Mm02_00313294 predicted 2260
8 SASI_Mm01_00185022 predicted 2871
9 SASI_Mm01_00185023 predicted 3429
10 SASI_Mm01_00185024 predicted 1325
11 SASI_Mm01_00185016 predicted 2075
12 SASI_Mm01_00185019 predicted 3000
13 SASI_Mm01_00185025 predicted 3247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000834
GRIN2B MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-598s1c1
Sequence:CCGGCCTCTATGATAATGGCAGATACTCGAGTATCTGCCATTATCATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-2491s1c1
Sequence:CCGGGCTATGGCATTGCCATCCAAACTCGAGTTTGGATGGCAATGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-1449s1c1
Sequence:CCGGGCACCATTTGTCATTGTGGAACTCGAGTTCCACAATGACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-1283s1c1
Sequence:CCGGGCACCCGAAACTGGTGATAATCTCGAGATTATCACCAGTTTCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-3382s1c1
Sequence:CCGGCCGATGTCTCTGACATCTCAACTCGAGTTGAGATGTCAGAGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000834.3-1160s21c1
Sequence:CCGGGAGAATCTACCAGTCCAATATCTCGAGATATTGGACTGGTAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000834.3-2376s21c1
Sequence:CCGGGCAGCAGTGCTGAACTATATGCTCGAGCATATAGTTCAGCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000834
GRIN2B MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-598s1c1
Sequence:CCGGCCTCTATGATAATGGCAGATACTCGAGTATCTGCCATTATCATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-2491s1c1
Sequence:CCGGGCTATGGCATTGCCATCCAAACTCGAGTTTGGATGGCAATGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-1449s1c1
Sequence:CCGGGCACCATTTGTCATTGTGGAACTCGAGTTCCACAATGACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-1283s1c1
Sequence:CCGGGCACCCGAAACTGGTGATAATCTCGAGATTATCACCAGTTTCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-3382s1c1
Sequence:CCGGCCGATGTCTCTGACATCTCAACTCGAGTTGAGATGTCAGAGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000834.3-1160s21c1
Sequence:CCGGGAGAATCTACCAGTCCAATATCTCGAGATATTGGACTGGTAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000834.3-2376s21c1
Sequence:CCGGGCAGCAGTGCTGAACTATATGCTCGAGCATATAGTTCAGCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000834
GRIN2B MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-598s1c1
Sequence:CCGGCCTCTATGATAATGGCAGATACTCGAGTATCTGCCATTATCATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-2491s1c1
Sequence:CCGGGCTATGGCATTGCCATCCAAACTCGAGTTTGGATGGCAATGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-1449s1c1
Sequence:CCGGGCACCATTTGTCATTGTGGAACTCGAGTTCCACAATGACAAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-1283s1c1
Sequence:CCGGGCACCCGAAACTGGTGATAATCTCGAGATTATCACCAGTTTCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000834.2-3382s1c1
Sequence:CCGGCCGATGTCTCTGACATCTCAACTCGAGTTGAGATGTCAGAGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000834.3-1160s21c1
Sequence:CCGGGAGAATCTACCAGTCCAATATCTCGAGATATTGGACTGGTAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000834.3-2376s21c1
Sequence:CCGGGCAGCAGTGCTGAACTATATGCTCGAGCATATAGTTCAGCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008171
GRIN2B MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-2282s1c1
Sequence:CCGGGCTATGGCATTGCTATCCAAACTCGAGTTTGGATAGCAATGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-3286s1c1
Sequence:CCGGGCCAAATCTAGGAGGGAGTTTCTCGAGAAACTCCCTCCTAGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-258s1c1
Sequence:CCGGCGATCTTATGTCTGACCGGAACTCGAGTTCCGGTCAGACATAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-1083s1c1
Sequence:CCGGGCTGGTGATAATCCTTCTGAACTCGAGTTCAGAAGGATTATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-2085s1c1
Sequence:CCGGCCGTAATAACTATGCAGAAATCTCGAGATTTCTGCATAGTTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008171
GRIN2B MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-2282s1c1
Sequence:CCGGGCTATGGCATTGCTATCCAAACTCGAGTTTGGATAGCAATGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-3286s1c1
Sequence:CCGGGCCAAATCTAGGAGGGAGTTTCTCGAGAAACTCCCTCCTAGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-258s1c1
Sequence:CCGGCGATCTTATGTCTGACCGGAACTCGAGTTCCGGTCAGACATAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-1083s1c1
Sequence:CCGGGCTGGTGATAATCCTTCTGAACTCGAGTTCAGAAGGATTATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-2085s1c1
Sequence:CCGGCCGTAATAACTATGCAGAAATCTCGAGATTTCTGCATAGTTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008171
GRIN2B MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-2282s1c1
Sequence:CCGGGCTATGGCATTGCTATCCAAACTCGAGTTTGGATAGCAATGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-3286s1c1
Sequence:CCGGGCCAAATCTAGGAGGGAGTTTCTCGAGAAACTCCCTCCTAGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-258s1c1
Sequence:CCGGCGATCTTATGTCTGACCGGAACTCGAGTTCCGGTCAGACATAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-1083s1c1
Sequence:CCGGGCTGGTGATAATCCTTCTGAACTCGAGTTCAGAAGGATTATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008171.2-2085s1c1
Sequence:CCGGCCGTAATAACTATGCAGAAATCTCGAGATTTCTGCATAGTTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks