EMAIL THIS PAGE TO A FRIEND

GRIN2C

glutamate receptor, ionotropic, N-methyl D-aspartate 2C

136 Gene Product Result for
Synonyms: GluN2C NMDAR2C NR2C
UniProtKB ID: Q14957, B2RTT1
Gene ID:
Human(2905) Summary: This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(14813) glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Rat(24411) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
sheep(101102915) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
domestic guinea pig(100721967) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
naked mole-rat(101698922) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
chicken(431090) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
dog(483302) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
cow(535158) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
domestic cat(101091740) glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M266 Anti-Glutamate Receptor NMDAR2C (NR2C) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, mouse, rat
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1405895 Anti-GRIN2C antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107924 Anti-GRIN2C antibody produced in rabbit affinity isolated antibody rat, mouse, zebrafish, canine, rabbit, guinea pig, bovine, pig, human
western blot pricing
SAB1410576 Anti-GRIN2C antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000835 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075851 MISSION® esiRNA esiRNA human GRIN2C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000835 Rosetta Predictions human pricing
NM_012575 Rosetta Predictions rat pricing
NM_010350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303331 predicted 2126
2 SASI_Hs01_00133911 predicted 4005
3 SASI_Hs02_00303332 predicted 2542
4 SASI_Hs01_00133912 predicted 1144
5 SASI_Hs01_00133914 predicted 1936
6 SASI_Hs01_00133915 predicted 2156
7 SASI_Hs01_00133916 predicted 236
8 SASI_Hs01_00133917 predicted 2214
9 SASI_Hs01_00133918 predicted 1519
10 SASI_Hs02_00303333 predicted 1904
11 SASI_Hs01_00133910 predicted 2046
12 SASI_Hs01_00133913 predicted 1750
13 SASI_Hs01_00133919 predicted 2024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041347 predicted 543
2 SASI_Rn01_00041348 predicted 3067
3 SASI_Rn01_00041349 predicted 2108
4 SASI_Rn01_00041350 predicted 1803
5 SASI_Rn01_00041351 predicted 2635
6 SASI_Rn01_00041352 predicted 2161
7 SASI_Rn01_00041354 predicted 2569
8 SASI_Rn01_00041353 predicted 1997
9 SASI_Rn01_00041355 predicted 4115
10 SASI_Rn01_00041356 predicted 4096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166956 predicted 2870
2 SASI_Mm01_00166957 predicted 3438
3 SASI_Mm01_00166958 predicted 2249
4 SASI_Mm01_00166959 predicted 1834
5 SASI_Mm01_00166960 predicted 1094
6 SASI_Mm01_00166961 predicted 2174
7 SASI_Mm01_00166962 predicted 3292
8 SASI_Mm01_00166963 predicted 2243
9 SASI_Mm01_00166964 predicted 3009
10 SASI_Mm01_00166965 predicted 2840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000835
GRIN2C MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000835.3-4008s21c1
Sequence:CCGGGTGACCTCAGTAGCCTCAAATCTCGAGATTTGAGGCTACTGAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000835.3-1622s21c1
Sequence:CCGGGCGTATGGAACGGCATGATTGCTCGAGCAATCATGCCGTTCCATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000835.3-1791s21c1
Sequence:CCGGGGCCTTCTTGGAGCCATATAGCTCGAGCTATATGGCTCCAAGAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1745s1c1
Sequence:CCGGCGTAGACTTCTCTGTACCCTTCTCGAGAAGGGTACAGAGAAGTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1559s1c1
Sequence:CCGGCTGCATCGACATCCTCAAGAACTCGAGTTCTTGAGGATGTCGATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-2264s1c1
Sequence:CCGGCCGCAGTAACTACCGTGACATCTCGAGATGTCACGGTAGTTACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1970s1c1
Sequence:CCGGCCCAGCTTTCACTATCGGCAACTCGAGTTGCCGATAGTGAAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-3557s1c1
Sequence:CCGGGCAGTCGATGTGCTTGCCGATCTCGAGATCGGCAAGCACATCGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000835
GRIN2C MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000835.3-4008s21c1
Sequence:CCGGGTGACCTCAGTAGCCTCAAATCTCGAGATTTGAGGCTACTGAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000835.3-1622s21c1
Sequence:CCGGGCGTATGGAACGGCATGATTGCTCGAGCAATCATGCCGTTCCATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000835.3-1791s21c1
Sequence:CCGGGGCCTTCTTGGAGCCATATAGCTCGAGCTATATGGCTCCAAGAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1745s1c1
Sequence:CCGGCGTAGACTTCTCTGTACCCTTCTCGAGAAGGGTACAGAGAAGTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1559s1c1
Sequence:CCGGCTGCATCGACATCCTCAAGAACTCGAGTTCTTGAGGATGTCGATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-2264s1c1
Sequence:CCGGCCGCAGTAACTACCGTGACATCTCGAGATGTCACGGTAGTTACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1970s1c1
Sequence:CCGGCCCAGCTTTCACTATCGGCAACTCGAGTTGCCGATAGTGAAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-3557s1c1
Sequence:CCGGGCAGTCGATGTGCTTGCCGATCTCGAGATCGGCAAGCACATCGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000835
GRIN2C MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000835.3-4008s21c1
Sequence:CCGGGTGACCTCAGTAGCCTCAAATCTCGAGATTTGAGGCTACTGAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000835.3-1622s21c1
Sequence:CCGGGCGTATGGAACGGCATGATTGCTCGAGCAATCATGCCGTTCCATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000835.3-1791s21c1
Sequence:CCGGGGCCTTCTTGGAGCCATATAGCTCGAGCTATATGGCTCCAAGAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1745s1c1
Sequence:CCGGCGTAGACTTCTCTGTACCCTTCTCGAGAAGGGTACAGAGAAGTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1559s1c1
Sequence:CCGGCTGCATCGACATCCTCAAGAACTCGAGTTCTTGAGGATGTCGATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-2264s1c1
Sequence:CCGGCCGCAGTAACTACCGTGACATCTCGAGATGTCACGGTAGTTACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-1970s1c1
Sequence:CCGGCCCAGCTTTCACTATCGGCAACTCGAGTTGCCGATAGTGAAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000835.2-3557s1c1
Sequence:CCGGGCAGTCGATGTGCTTGCCGATCTCGAGATCGGCAAGCACATCGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010350
GRIN2C MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010350.1-4639s1c1
Sequence:CCGGGCTTATGACCTTAGCAGCTTACTCGAGTAAGCTGCTAAGGTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2869s1c1
Sequence:CCGGGCACACTCACATGGTCAAGTTCTCGAGAACTTGACCATGTGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-3889s1c1
Sequence:CCGGGCGCCCATTTCTCCCGCTATTCTCGAGAATAGCGGGAGAAATGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2317s1c1
Sequence:CCGGGCGCTCAGAGATTATAGACTTCTCGAGAAGTCTATAATCTCTGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2319s1c1
Sequence:CCGGGCTCAGAGATTATAGACTTCTCTCGAGAGAAGTCTATAATCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010350
GRIN2C MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010350.1-4639s1c1
Sequence:CCGGGCTTATGACCTTAGCAGCTTACTCGAGTAAGCTGCTAAGGTCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2869s1c1
Sequence:CCGGGCACACTCACATGGTCAAGTTCTCGAGAACTTGACCATGTGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-3889s1c1
Sequence:CCGGGCGCCCATTTCTCCCGCTATTCTCGAGAATAGCGGGAGAAATGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2317s1c1
Sequence:CCGGGCGCTCAGAGATTATAGACTTCTCGAGAAGTCTATAATCTCTGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2319s1c1
Sequence:CCGGGCTCAGAGATTATAGACTTCTCTCGAGAGAAGTCTATAATCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010350
GRIN2C MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010350.1-4639s1c1
Sequence:CCGGGCTTATGACCTTAGCAGCTTACTCGAGTAAGCTGCTAAGGTCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2869s1c1
Sequence:CCGGGCACACTCACATGGTCAAGTTCTCGAGAACTTGACCATGTGAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-3889s1c1
Sequence:CCGGGCGCCCATTTCTCCCGCTATTCTCGAGAATAGCGGGAGAAATGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2317s1c1
Sequence:CCGGGCGCTCAGAGATTATAGACTTCTCGAGAAGTCTATAATCTCTGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010350.1-2319s1c1
Sequence:CCGGGCTCAGAGATTATAGACTTCTCTCGAGAGAAGTCTATAATCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)