EMAIL THIS PAGE TO A FRIEND

GRIN2D

glutamate receptor, ionotropic, N-methyl D-aspartate 2D

Synonyms: EB11 GluN2D NMDAR2D NR2D
UniProtKB ID: O15399
Gene ID:
Human(2906) Summary: N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
Mouse(14814) glutamate receptor, ionotropic, NMDA2D (epsilon 4)
Rat(24412) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
dog(484405) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
cow(618181) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
domestic cat(101095061) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
domestic guinea pig(100731717) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
naked mole-rat(101710918) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
sheep(101105943) glutamate receptor, ionotropic, N-methyl D-aspartate 2D
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000836 Rosetta Predictions human pricing
NM_022797 Rosetta Predictions rat pricing
NM_008172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208910 predicted 1200
2 SASI_Hs01_00208911 predicted 1156
3 SASI_Hs01_00208912 predicted 2275
4 SASI_Hs01_00208913 predicted 2254
5 SASI_Hs01_00208914 predicted 1613
6 SASI_Hs01_00208915 predicted 1624
7 SASI_Hs01_00208916 predicted 809
8 SASI_Hs01_00208917 predicted 628
9 SASI_Hs01_00208918 predicted 1862
10 SASI_Hs01_00208919 predicted 2147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114600 predicted 3239
2 SASI_Rn01_00114601 predicted 2714
3 SASI_Rn01_00114602 predicted 2297
4 SASI_Rn01_00114603 predicted 3196
5 SASI_Rn01_00114604 predicted 2912
6 SASI_Rn01_00114605 predicted 1844
7 SASI_Rn01_00114606 predicted 2602
8 SASI_Rn01_00114607 predicted 2268
9 SASI_Rn01_00114608 predicted 2186
10 SASI_Rn02_00263552 predicted 1755
11 SASI_Rn01_00114599 predicted 3086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084794 predicted 2459
2 SASI_Mm01_00084785 predicted 1974
3 SASI_Mm01_00084786 predicted 2292
4 SASI_Mm01_00084787 predicted 1213
5 SASI_Mm01_00084788 predicted 1642
6 SASI_Mm01_00084789 predicted 1559
7 SASI_Mm01_00084790 predicted 2103
8 SASI_Mm01_00084791 predicted 2266
9 SASI_Mm01_00084792 predicted 1249
10 SASI_Mm02_00313295 predicted 2567
11 SASI_Mm01_00084793 predicted 2122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000836
VALIDATED
GRIN2D MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000836.1-3101s1c1
Sequence:CCGGGCCTCCTATTTCGCCATCGTACTCGAGTACGATGGCGAAATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000836.1-2254s1c1
Sequence:CCGGCCGCAGCAACTATCCCGACATCTCGAGATGTCGGGATAGTTGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-2275s1c1
Sequence:CCGGGCACAGCTACATGGTGCGCTACTCGAGTAGCGCACCATGTAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-1162s1c1
Sequence:CCGGGAGTCTGCATAGGTACTTCATCTCGAGATGAAGTACCTATGCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-1201s1c1
Sequence:CCGGCCGGGATTACTCCTTCAATGACTCGAGTCATTGAAGGAGTAATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000836.2-4888s21c1
Sequence:CCGGCTCCAAATCCAACCCTTATTTCTCGAGAAATAAGGGTTGGATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000836.2-2362s21c1
Sequence:CCGGCGATGCTGCAGTGCTCAATTACTCGAGTAATTGAGCACTGCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000836.2-1542s21c1
Sequence:CCGGAGGGTTTCTGCATCGACATTCCTCGAGGAATGTCGATGCAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000836.2-2247s21c1
Sequence:CCGGAGAACATCCGCAGCAACTATCCTCGAGGATAGTTGCTGCGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000836
VALIDATED
GRIN2D MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000836.1-3101s1c1
Sequence:CCGGGCCTCCTATTTCGCCATCGTACTCGAGTACGATGGCGAAATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000836.1-2254s1c1
Sequence:CCGGCCGCAGCAACTATCCCGACATCTCGAGATGTCGGGATAGTTGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-2275s1c1
Sequence:CCGGGCACAGCTACATGGTGCGCTACTCGAGTAGCGCACCATGTAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-1162s1c1
Sequence:CCGGGAGTCTGCATAGGTACTTCATCTCGAGATGAAGTACCTATGCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-1201s1c1
Sequence:CCGGCCGGGATTACTCCTTCAATGACTCGAGTCATTGAAGGAGTAATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000836.2-4888s21c1
Sequence:CCGGCTCCAAATCCAACCCTTATTTCTCGAGAAATAAGGGTTGGATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000836.2-2362s21c1
Sequence:CCGGCGATGCTGCAGTGCTCAATTACTCGAGTAATTGAGCACTGCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000836.2-1542s21c1
Sequence:CCGGAGGGTTTCTGCATCGACATTCCTCGAGGAATGTCGATGCAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000836.2-2247s21c1
Sequence:CCGGAGAACATCCGCAGCAACTATCCTCGAGGATAGTTGCTGCGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000836
VALIDATED
GRIN2D MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000836.1-3101s1c1
Sequence:CCGGGCCTCCTATTTCGCCATCGTACTCGAGTACGATGGCGAAATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000836.1-2254s1c1
Sequence:CCGGCCGCAGCAACTATCCCGACATCTCGAGATGTCGGGATAGTTGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-2275s1c1
Sequence:CCGGGCACAGCTACATGGTGCGCTACTCGAGTAGCGCACCATGTAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-1162s1c1
Sequence:CCGGGAGTCTGCATAGGTACTTCATCTCGAGATGAAGTACCTATGCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000836.1-1201s1c1
Sequence:CCGGCCGGGATTACTCCTTCAATGACTCGAGTCATTGAAGGAGTAATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000836.2-4888s21c1
Sequence:CCGGCTCCAAATCCAACCCTTATTTCTCGAGAAATAAGGGTTGGATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000836.2-2362s21c1
Sequence:CCGGCGATGCTGCAGTGCTCAATTACTCGAGTAATTGAGCACTGCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000836.2-1542s21c1
Sequence:CCGGAGGGTTTCTGCATCGACATTCCTCGAGGAATGTCGATGCAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000836.2-2247s21c1
Sequence:CCGGAGAACATCCGCAGCAACTATCCTCGAGGATAGTTGCTGCGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008172
GRIN2D MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1071s1c1
Sequence:CCGGGCACAGGTATTTCATGAACATCTCGAGATGTTCATGAAATACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1990s1c1
Sequence:CCGGGTCATCTTTCTTGCCAGCTATCTCGAGATAGCTGGCAAGAAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-3417s1c1
Sequence:CCGGCCGCTACTGGTCGGTTGACAACTCGAGTTGTCAACCGACCAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1431s1c1
Sequence:CCGGGAAGAGATGCTGCAAGGGTTTCTCGAGAAACCCTTGCAGCATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-2141s1c1
Sequence:CCGGCCACGGAGAAGAATATCCGAACTCGAGTTCGGATATTCTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008172
GRIN2D MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1071s1c1
Sequence:CCGGGCACAGGTATTTCATGAACATCTCGAGATGTTCATGAAATACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1990s1c1
Sequence:CCGGGTCATCTTTCTTGCCAGCTATCTCGAGATAGCTGGCAAGAAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-3417s1c1
Sequence:CCGGCCGCTACTGGTCGGTTGACAACTCGAGTTGTCAACCGACCAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1431s1c1
Sequence:CCGGGAAGAGATGCTGCAAGGGTTTCTCGAGAAACCCTTGCAGCATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-2141s1c1
Sequence:CCGGCCACGGAGAAGAATATCCGAACTCGAGTTCGGATATTCTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008172
GRIN2D MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1071s1c1
Sequence:CCGGGCACAGGTATTTCATGAACATCTCGAGATGTTCATGAAATACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1990s1c1
Sequence:CCGGGTCATCTTTCTTGCCAGCTATCTCGAGATAGCTGGCAAGAAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-3417s1c1
Sequence:CCGGCCGCTACTGGTCGGTTGACAACTCGAGTTGTCAACCGACCAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-1431s1c1
Sequence:CCGGGAAGAGATGCTGCAAGGGTTTCTCGAGAAACCCTTGCAGCATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008172.1-2141s1c1
Sequence:CCGGCCACGGAGAAGAATATCCGAACTCGAGTTCGGATATTCTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks