EMAIL THIS PAGE TO A FRIEND

GRIN3A

glutamate receptor, ionotropic, N-methyl-D-aspartate 3A

Synonyms: GluN3A NMDAR-L NR3A
UniProtKB ID: Q8TCU5, B3DLF9, Q5VTR3, Q8TF29, Q8WXI6
Gene ID:
Human(116443) Summary: This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
Mouse(242443) glutamate receptor ionotropic, NMDA3A
Rat(191573) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
chicken(769001) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
domestic cat(101098262) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
Horse(100062954) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
cow(100295209) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
dog(474789) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
sheep(101120547) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
Domestic Rabbit(100343526) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
domestic guinea pig(100721429) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
naked mole-rat(101711032) glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301424 ANTI-GRIN3A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1301425 ANTI-GRIN3A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D2531 Dextromethorphan hydrobromide monohydrate ≥99% (TLC) human pricing
M107 (+)-MK-801 hydrogen maleate powder human, mouse, rat pricing
N179 NS 102 solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133445 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203021 MISSION® esiRNA esiRNA targeting mouse Grin3a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133445 Rosetta Predictions human pricing
NM_001033351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089651 predicted 3144
2 SASI_Hs01_00089652 predicted 1878
3 SASI_Hs01_00089653 predicted 1204
4 SASI_Hs01_00089654 predicted 3652
5 SASI_Hs01_00089655 predicted 2291
6 SASI_Hs01_00089656 predicted 1365
7 SASI_Hs01_00089657 predicted 1307
8 SASI_Hs01_00089658 predicted 1454
9 SASI_Hs01_00089659 predicted 1834
10 SASI_Hs02_00363118 predicted 2974
11 SASI_Hs01_00089660 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288639 predicted 2541
2 SASI_Mm02_00288640 predicted 1633
3 SASI_Mm02_00288641 predicted 907
4 SASI_Mm02_00288642 predicted 1547
5 SASI_Mm02_00288643 predicted 764
6 SASI_Mm02_00288644 predicted 1522
7 SASI_Mm02_00288645 predicted 2651
8 SASI_Mm02_00288646 predicted 2226
9 SASI_Mm02_00288647 predicted 2675
10 SASI_Mm02_00288648 predicted 2596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133445
GRIN3A MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133445.2-4347s21c1
Sequence:CCGGCGTAACACAGAACGAGGTTATCTCGAGATAACCTCGTTCTGTGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133445.2-3448s21c1
Sequence:CCGGCATTGGTGAGCACATAGTATACTCGAGTATACTATGTGCTCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-3253s1c1
Sequence:CCGGCGCCAACATATCCGAGCTAATCTCGAGATTAGCTCGGATATGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-1024s1c1
Sequence:CCGGGCTACCCTACAACCTGTCTTTCTCGAGAAAGACAGGTTGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-2115s1c1
Sequence:CCGGCCCACTTCCAACATCCAAGTACTCGAGTACTTGGATGTTGGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-3005s1c1
Sequence:CCGGGCTGAAGATTATGTGAGACAACTCGAGTTGTCTCACATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-1438s1c1
Sequence:CCGGCCTCCTCCTTACCCAGAATAACTCGAGTTATTCTGGGTAAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133445
GRIN3A MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133445.2-4347s21c1
Sequence:CCGGCGTAACACAGAACGAGGTTATCTCGAGATAACCTCGTTCTGTGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133445.2-3448s21c1
Sequence:CCGGCATTGGTGAGCACATAGTATACTCGAGTATACTATGTGCTCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-3253s1c1
Sequence:CCGGCGCCAACATATCCGAGCTAATCTCGAGATTAGCTCGGATATGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-1024s1c1
Sequence:CCGGGCTACCCTACAACCTGTCTTTCTCGAGAAAGACAGGTTGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-2115s1c1
Sequence:CCGGCCCACTTCCAACATCCAAGTACTCGAGTACTTGGATGTTGGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-3005s1c1
Sequence:CCGGGCTGAAGATTATGTGAGACAACTCGAGTTGTCTCACATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-1438s1c1
Sequence:CCGGCCTCCTCCTTACCCAGAATAACTCGAGTTATTCTGGGTAAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133445
GRIN3A MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133445.2-4347s21c1
Sequence:CCGGCGTAACACAGAACGAGGTTATCTCGAGATAACCTCGTTCTGTGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133445.2-3448s21c1
Sequence:CCGGCATTGGTGAGCACATAGTATACTCGAGTATACTATGTGCTCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-3253s1c1
Sequence:CCGGCGCCAACATATCCGAGCTAATCTCGAGATTAGCTCGGATATGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-1024s1c1
Sequence:CCGGGCTACCCTACAACCTGTCTTTCTCGAGAAAGACAGGTTGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-2115s1c1
Sequence:CCGGCCCACTTCCAACATCCAAGTACTCGAGTACTTGGATGTTGGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-3005s1c1
Sequence:CCGGGCTGAAGATTATGTGAGACAACTCGAGTTGTCTCACATAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133445.1-1438s1c1
Sequence:CCGGCCTCCTCCTTACCCAGAATAACTCGAGTTATTCTGGGTAAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks