EMAIL THIS PAGE TO A FRIEND

GRIN3B

glutamate receptor, ionotropic, N-methyl-D-aspartate 3B

59 Gene Product Result for
Synonyms: GluN3B NR3B
UniProtKB ID: O60391, Q5EAK7, Q7RTW9
Gene ID:
Mouse(170483) glutamate receptor, ionotropic, NMDA3B
Rat(170796) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
domestic guinea pig(100726052) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
naked mole-rat(101711021) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
sheep(101112396) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
chicken(429171) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
dog(485092) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
domestic cat(101094736) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
cow(616000) glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D2531 Dextromethorphan hydrobromide monohydrate ≥99% (TLC) human pricing
M107 (+)-MK-801 hydrogen maleate powder human, mouse, rat pricing
N179 NS 102 solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138690 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138690 Rosetta Predictions human pricing
NM_133308 Rosetta Predictions rat pricing
NM_130455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063636 predicted 2299
2 SASI_Hs01_00063638 predicted 1468
3 SASI_Hs01_00063639 predicted 2341
4 SASI_Hs01_00063640 predicted 2375
5 SASI_Hs01_00063641 predicted 2261
6 SASI_Hs01_00063642 predicted 1253
7 SASI_Hs01_00063643 predicted 1086
8 SASI_Hs02_00363783 predicted 2256
9 SASI_Hs01_00063644 predicted 2408
10 SASI_Hs01_00063645 predicted 1410
11 SASI_Hs01_00063637 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073445 predicted 1344
2 SASI_Rn01_00073446 predicted 2437
3 SASI_Rn01_00073448 predicted 1730
4 SASI_Rn01_00073449 predicted 2376
5 SASI_Rn01_00073450 predicted 1359
6 SASI_Rn02_00267603 predicted 917
7 SASI_Rn01_00073451 predicted 1308
8 SASI_Rn02_00267604 predicted 1491
9 SASI_Rn01_00073453 predicted 1673
10 SASI_Rn01_00073454 predicted 983
11 SASI_Rn01_00073447 predicted 1553
12 SASI_Rn01_00073452 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092456 predicted 2413
2 SASI_Mm01_00092458 predicted 2531
3 SASI_Mm02_00338262 predicted 2534
4 SASI_Mm01_00092459 predicted 1937
5 SASI_Mm01_00092460 predicted 2106
6 SASI_Mm01_00092461 predicted 1448
7 SASI_Mm01_00092462 predicted 2400
8 SASI_Mm01_00092463 predicted 1207
9 SASI_Mm01_00092465 predicted 692
10 SASI_Mm02_00338263 predicted 802
11 SASI_Mm01_00092457 predicted 1597
12 SASI_Mm01_00092464 predicted 1654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138690
GRIN3B MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-1266s1c1
Sequence:CCGGGTTGGAACACCCATTTGTGTTCTCGAGAACACAAATGGGTGTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-876s1c1
Sequence:CCGGCATCCATGACATTGTGCAACTCTCGAGAGTTGCACAATGTCATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-2472s1c1
Sequence:CCGGGCAGATGAGCATCTACCACTTCTCGAGAAGTGGTAGATGCTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-1834s21c1
Sequence:CCGGACCGTCTTCTCCTACTCCTCACTCGAGTGAGGAGTAGGAGAAGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-1865s21c1
Sequence:CCGGTGTGCTACGCCATCCTCTTCACTCGAGTGAAGAGGATGGCGTAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-2365s21c1
Sequence:CCGGGAGTTCATCAGCCGCTACAAGCTCGAGCTTGTAGCGGCTGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-2409s1c1
Sequence:CCGGCCACGACAAGTGGTACAAGATCTCGAGATCTTGTACCACTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-1586s1c1
Sequence:CCGGTCACCAGCTTCAGTATCAACTCTCGAGAGTTGATACTGAAGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138690
GRIN3B MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-1266s1c1
Sequence:CCGGGTTGGAACACCCATTTGTGTTCTCGAGAACACAAATGGGTGTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-876s1c1
Sequence:CCGGCATCCATGACATTGTGCAACTCTCGAGAGTTGCACAATGTCATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-2472s1c1
Sequence:CCGGGCAGATGAGCATCTACCACTTCTCGAGAAGTGGTAGATGCTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-1834s21c1
Sequence:CCGGACCGTCTTCTCCTACTCCTCACTCGAGTGAGGAGTAGGAGAAGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-1865s21c1
Sequence:CCGGTGTGCTACGCCATCCTCTTCACTCGAGTGAAGAGGATGGCGTAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-2365s21c1
Sequence:CCGGGAGTTCATCAGCCGCTACAAGCTCGAGCTTGTAGCGGCTGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-2409s1c1
Sequence:CCGGCCACGACAAGTGGTACAAGATCTCGAGATCTTGTACCACTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-1586s1c1
Sequence:CCGGTCACCAGCTTCAGTATCAACTCTCGAGAGTTGATACTGAAGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138690
GRIN3B MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-1266s1c1
Sequence:CCGGGTTGGAACACCCATTTGTGTTCTCGAGAACACAAATGGGTGTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-876s1c1
Sequence:CCGGCATCCATGACATTGTGCAACTCTCGAGAGTTGCACAATGTCATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-2472s1c1
Sequence:CCGGGCAGATGAGCATCTACCACTTCTCGAGAAGTGGTAGATGCTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-1834s21c1
Sequence:CCGGACCGTCTTCTCCTACTCCTCACTCGAGTGAGGAGTAGGAGAAGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-1865s21c1
Sequence:CCGGTGTGCTACGCCATCCTCTTCACTCGAGTGAAGAGGATGGCGTAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138690.1-2365s21c1
Sequence:CCGGGAGTTCATCAGCCGCTACAAGCTCGAGCTTGTAGCGGCTGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-2409s1c1
Sequence:CCGGCCACGACAAGTGGTACAAGATCTCGAGATCTTGTACCACTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138690.1-1586s1c1
Sequence:CCGGTCACCAGCTTCAGTATCAACTCTCGAGAGTTGATACTGAAGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130455
GRIN3B MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-2582s1c1
Sequence:CCGGGCTCCATGACAAGTGGTACAACTCGAGTTGTACCACTTGTCATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-1651s1c1
Sequence:CCGGCCTTTGACTTTGAGCTCTATACTCGAGTATAGAGCTCAAAGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-2792s1c1
Sequence:CCGGGCTTCACACGAGCCAGAAGATCTCGAGATCTTCTGGCTCGTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-1137s1c1
Sequence:CCGGGTAAATTGTGAGGACCTGAAACTCGAGTTTCAGGTCCTCACAATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-2662s21c1
Sequence:CCGGACCACTTGTCAGGGTTGTTTGCTCGAGCAAACAACCCTGACAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-1259s21c1
Sequence:CCGGGGTGCATGTGTCTCGGCATTTCTCGAGAAATGCCGAGACACATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-2396s21c1
Sequence:CCGGCGCCTTCATCATGGATAAATCCTCGAGGATTTATCCATGATGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130455
GRIN3B MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-2582s1c1
Sequence:CCGGGCTCCATGACAAGTGGTACAACTCGAGTTGTACCACTTGTCATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-1651s1c1
Sequence:CCGGCCTTTGACTTTGAGCTCTATACTCGAGTATAGAGCTCAAAGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-2792s1c1
Sequence:CCGGGCTTCACACGAGCCAGAAGATCTCGAGATCTTCTGGCTCGTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-1137s1c1
Sequence:CCGGGTAAATTGTGAGGACCTGAAACTCGAGTTTCAGGTCCTCACAATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-2662s21c1
Sequence:CCGGACCACTTGTCAGGGTTGTTTGCTCGAGCAAACAACCCTGACAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-1259s21c1
Sequence:CCGGGGTGCATGTGTCTCGGCATTTCTCGAGAAATGCCGAGACACATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-2396s21c1
Sequence:CCGGCGCCTTCATCATGGATAAATCCTCGAGGATTTATCCATGATGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130455
GRIN3B MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-2582s1c1
Sequence:CCGGGCTCCATGACAAGTGGTACAACTCGAGTTGTACCACTTGTCATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-1651s1c1
Sequence:CCGGCCTTTGACTTTGAGCTCTATACTCGAGTATAGAGCTCAAAGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-2792s1c1
Sequence:CCGGGCTTCACACGAGCCAGAAGATCTCGAGATCTTCTGGCTCGTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130455.2-1137s1c1
Sequence:CCGGGTAAATTGTGAGGACCTGAAACTCGAGTTTCAGGTCCTCACAATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-2662s21c1
Sequence:CCGGACCACTTGTCAGGGTTGTTTGCTCGAGCAAACAACCCTGACAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-1259s21c1
Sequence:CCGGGGTGCATGTGTCTCGGCATTTCTCGAGAAATGCCGAGACACATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130455.2-2396s21c1
Sequence:CCGGCGCCTTCATCATGGATAAATCCTCGAGGATTTATCCATGATGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks