EMAIL THIS PAGE TO A FRIEND

GRINA

glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)

116 Gene Product Result for
Synonyms: HNRGW LFG1 NMDARA1 TMBIM3
UniProtKB ID: Q7Z429, B3KXM7, O43836, Q8IVW7
Gene ID:
Mouse(66168) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Rat(266668) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Zebrafish(394183) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
cow(510225) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Horse(100065426) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
domestic cat(101093245) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
dog(475118) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
sheep(101114619) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
domestic guinea pig(100735991) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
naked mole-rat(101708250) glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068091 MISSION® esiRNA esiRNA human GRINA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000837 Rosetta Predictions human pricing
NM_001009184 Rosetta Predictions human pricing
NM_153308 Rosetta Predictions rat pricing
NM_023168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073501 predicted 1145
2 SASI_Hs02_00303334 predicted 1347
3 SASI_Hs01_00073502 predicted 1029
4 SASI_Hs01_00073504 predicted 1297
5 SASI_Hs01_00073505 predicted 856
6 SASI_Hs01_00073506 predicted 1540
7 SASI_Hs01_00073507 predicted 1163
8 SASI_Hs01_00073508 predicted 1514
9 SASI_Hs01_00073509 predicted 1322
10 SASI_Hs01_00073510 predicted 1515
11 SASI_Hs01_00073503 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122278 predicted 1037
2 SASI_Hs02_00305609 predicted 1243
3 SASI_Hs01_00122279 predicted 917
4 SASI_Hs01_00122281 predicted 1181
5 SASI_Hs01_00122282 predicted 748
6 SASI_Hs01_00122283 predicted 1429
7 SASI_Hs01_00122284 predicted 1058
8 SASI_Hs01_00122285 predicted 1405
9 SASI_Hs01_00122286 predicted 1209
10 SASI_Hs01_00122287 predicted 1403
11 SASI_Hs01_00122280 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078336 predicted 641
2 SASI_Rn01_00078337 predicted 737
3 SASI_Rn01_00078338 predicted 954
4 SASI_Rn02_00268954 predicted 648
5 SASI_Rn01_00078340 predicted 482
6 SASI_Rn01_00078341 predicted 1163
7 SASI_Rn01_00078342 predicted 754
8 SASI_Rn01_00078343 predicted 1345
9 SASI_Rn01_00078344 predicted 1109
10 SASI_Rn02_00268955 predicted 1386
11 SASI_Rn01_00078335 predicted 1309
12 SASI_Rn01_00078339 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122573 predicted 479
2 SASI_Mm01_00122574 predicted 1387
3 SASI_Mm01_00122575 predicted 250
4 SASI_Mm01_00122576 predicted 1274
5 SASI_Mm01_00122577 predicted 928
6 SASI_Mm01_00122578 predicted 791
7 SASI_Mm01_00122579 predicted 1443
8 SASI_Mm01_00122580 predicted 482
9 SASI_Mm01_00122581 predicted 947
10 SASI_Mm02_00326892 predicted 618
11 SASI_Mm01_00122582 predicted 1316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291268
GRINA MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-805s1c1
Sequence:CCGGGTGCTCTTCATCTTCGCCATTCTCGAGAATGGCGAAGATGAAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-1074s1c1
Sequence:CCGGCCTGTCTACTCATTGTTGCATCTCGAGATGCAACAATGAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-523s1c1
Sequence:CCGGTGGACCTACTATGTCTCCTATCTCGAGATAGGAGACATAGTAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-280s1c1
Sequence:CCGGCCACAGGTCTTCCCAGGACAACTCGAGTTGTCCTGGGAAGACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-993s1c1
Sequence:CCGGCATCATCAACATCTTCCTGTACTCGAGTACAGGAAGATGTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291268
GRINA MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-805s1c1
Sequence:CCGGGTGCTCTTCATCTTCGCCATTCTCGAGAATGGCGAAGATGAAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-1074s1c1
Sequence:CCGGCCTGTCTACTCATTGTTGCATCTCGAGATGCAACAATGAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-523s1c1
Sequence:CCGGTGGACCTACTATGTCTCCTATCTCGAGATAGGAGACATAGTAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-280s1c1
Sequence:CCGGCCACAGGTCTTCCCAGGACAACTCGAGTTGTCCTGGGAAGACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-993s1c1
Sequence:CCGGCATCATCAACATCTTCCTGTACTCGAGTACAGGAAGATGTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291268
GRINA MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-805s1c1
Sequence:CCGGGTGCTCTTCATCTTCGCCATTCTCGAGAATGGCGAAGATGAAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-1074s1c1
Sequence:CCGGCCTGTCTACTCATTGTTGCATCTCGAGATGCAACAATGAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-523s1c1
Sequence:CCGGTGGACCTACTATGTCTCCTATCTCGAGATAGGAGACATAGTAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-280s1c1
Sequence:CCGGCCACAGGTCTTCCCAGGACAACTCGAGTTGTCCTGGGAAGACCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291268.4-993s1c1
Sequence:CCGGCATCATCAACATCTTCCTGTACTCGAGTACAGGAAGATGTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023168
VALIDATED
GRINA MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-1375s1c1
Sequence:CCGGGCTGCATTTCTGTGCCACCTTCTCGAGAAGGTGGCACAGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-630s1c1
Sequence:CCGGCTGGACCTACTATGTCTCCTACTCGAGTAGGAGACATAGTAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023168.2-1113s1c1
Sequence:CCGGCTTCCTATATATTCTCACCATCTCGAGATGGTGAGAATATATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-453s1c1
Sequence:CCGGGCCTCCATCCTACTATGACAACTCGAGTTGTCATAGTAGGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-1086s1c1
Sequence:CCGGGAACCTGTACACGGACATCATCTCGAGATGATGTCCGTGTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023168
VALIDATED
GRINA MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-1375s1c1
Sequence:CCGGGCTGCATTTCTGTGCCACCTTCTCGAGAAGGTGGCACAGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-630s1c1
Sequence:CCGGCTGGACCTACTATGTCTCCTACTCGAGTAGGAGACATAGTAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023168.2-1113s1c1
Sequence:CCGGCTTCCTATATATTCTCACCATCTCGAGATGGTGAGAATATATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-453s1c1
Sequence:CCGGGCCTCCATCCTACTATGACAACTCGAGTTGTCATAGTAGGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-1086s1c1
Sequence:CCGGGAACCTGTACACGGACATCATCTCGAGATGATGTCCGTGTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023168
VALIDATED
GRINA MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-1375s1c1
Sequence:CCGGGCTGCATTTCTGTGCCACCTTCTCGAGAAGGTGGCACAGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-630s1c1
Sequence:CCGGCTGGACCTACTATGTCTCCTACTCGAGTAGGAGACATAGTAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023168.2-1113s1c1
Sequence:CCGGCTTCCTATATATTCTCACCATCTCGAGATGGTGAGAATATATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-453s1c1
Sequence:CCGGGCCTCCATCCTACTATGACAACTCGAGTTGTCATAGTAGGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023168.2-1086s1c1
Sequence:CCGGGAACCTGTACACGGACATCATCTCGAGATGATGTCCGTGTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks