EMAIL THIS PAGE TO A FRIEND

GRIP1

glutamate receptor interacting protein 1

76 Gene Product Result for
Synonyms: GRIP
UniProtKB ID: Q9Y3R0, C9JT59, Q1RLM0
Gene ID:
Human(23426) Summary: This gene encodes a member of the glutamate receptor interacting protein family. The encoded scaffold protein binds to and mediates the trafficking and membrane organization of a number of transmembrane proteins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
Mouse(74053) glutamate receptor interacting protein 1
Rat(84016) glutamate receptor interacting protein 1
Zebrafish(558006) glutamate receptor interacting protein 1
cow(525592) glutamate receptor interacting protein 1
Horse(100058112) glutamate receptor interacting protein 1
domestic cat(101090781) glutamate receptor interacting protein 1
dog(474434) glutamate receptor interacting protein 1
chicken(427863) glutamate receptor interacting protein 1
domestic guinea pig(100729196) glutamate receptor interacting protein 1
naked mole-rat(101703095) glutamate receptor interacting protein 1
sheep(101115022) glutamate receptor interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021150 Rosetta Predictions human pricing
NM_032069 Rosetta Predictions rat pricing
NM_028736 Rosetta Predictions mouse pricing
NM_130891 Rosetta Predictions mouse pricing
NM_133442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051478 predicted 2833
2 SASI_Hs01_00051479 predicted 2362
3 SASI_Hs01_00051480 predicted 861
4 SASI_Hs01_00051482 predicted 2966
5 SASI_Hs01_00051483 predicted 929
6 SASI_Hs01_00051485 predicted 689
7 SASI_Hs01_00051486 predicted 2090
8 SASI_Hs01_00051487 predicted 1639
9 SASI_Hs02_00354688 predicted 3043
10 SASI_Hs02_00354689 predicted 3061
11 SASI_Hs01_00051481 predicted 1665
12 SASI_Hs01_00051484 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044418 predicted 3275
2 SASI_Rn01_00044419 predicted 381
3 SASI_Rn01_00044420 predicted 2937
4 SASI_Rn02_00265427 predicted 1852
5 SASI_Rn01_00044422 predicted 846
6 SASI_Rn01_00044423 predicted 982
7 SASI_Rn01_00044424 predicted 494
8 SASI_Rn01_00044425 predicted 3339
9 SASI_Rn01_00044426 predicted 1112
10 SASI_Rn01_00044427 predicted 2230
11 SASI_Rn01_00044421 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038682 predicted 1561
2 SASI_Mm01_00038683 predicted 1954
3 SASI_Mm01_00038684 predicted 1924
4 SASI_Mm01_00038685 predicted 2322
5 SASI_Mm01_00038686 predicted 588
6 SASI_Mm01_00038687 predicted 859
7 SASI_Mm01_00038688 predicted 2119
8 SASI_Mm01_00038689 predicted 727
9 SASI_Mm02_00334311 predicted 1725
10 SASI_Mm01_00038690 predicted 1793
11 SASI_Mm01_00038691 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043511 predicted 1326
2 SASI_Mm01_00043512 predicted 1716
3 SASI_Mm01_00043513 predicted 1689
4 SASI_Mm01_00043514 predicted 2088
5 SASI_Mm01_00043515 predicted 506
6 SASI_Mm01_00043516 predicted 777
7 SASI_Mm01_00043517 predicted 1880
8 SASI_Mm01_00043518 predicted 649
9 SASI_Mm02_00338329 predicted 1480
10 SASI_Mm01_00043519 predicted 1553
11 SASI_Mm01_00043520 predicted 1625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111103 predicted 1306
2 SASI_Mm01_00111104 predicted 1702
3 SASI_Mm01_00111105 predicted 1675
4 SASI_Mm01_00111106 predicted 2068
5 SASI_Mm01_00111107 predicted 491
6 SASI_Mm01_00111108 predicted 770
7 SASI_Mm01_00111109 predicted 1868
8 SASI_Mm01_00111110 predicted 632
9 SASI_Mm02_00338559 predicted 1472
10 SASI_Mm01_00111111 predicted 1541
11 SASI_Mm01_00111112 predicted 1617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028736
VALIDATED
GRIP1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-1563s1c1
Sequence:CCGGCCGCCTCTGATTTCCTATATTCTCGAGAATATAGGAAATCAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-1566s1c1
Sequence:CCGGCCTCTGATTTCCTATATTGAACTCGAGTTCAATATAGGAAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028736.1-1714s1c1
Sequence:CCGGCGAGCAAAGTCACACTAGAAACTCGAGTTTCTAGTGTGACTTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-3300s1c1
Sequence:CCGGGACCTGGTTATTAGCAGAAATCTCGAGATTTCTGCTAATAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028736.1-2213s1c1
Sequence:CCGGCGGAGATAGAATCCTAGCCATCTCGAGATGGCTAGGATTCTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-1563s21c1
Sequence:CCGGCCGCCTCTGATTTCCTATATTCTCGAGAATATAGGAAATCAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-3300s21c1
Sequence:CCGGGACCTGGTTATTAGCAGAAATCTCGAGATTTCTGCTAATAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028736.1-2058s21c1
Sequence:CCGGGAGAGTTCCGGAGCGATTATTCTCGAGAATAATCGCTCCGGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-2138s21c1
Sequence:CCGGAGAGCCGTTTGATCCTATTATCTCGAGATAATAGGATCAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028736.1-269s21c1
Sequence:CCGGGGTATCGGGAGGCATTGATAACTCGAGTTATCAATGCCTCCCGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028736
VALIDATED
GRIP1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-1563s1c1
Sequence:CCGGCCGCCTCTGATTTCCTATATTCTCGAGAATATAGGAAATCAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-1566s1c1
Sequence:CCGGCCTCTGATTTCCTATATTGAACTCGAGTTCAATATAGGAAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028736.1-1714s1c1
Sequence:CCGGCGAGCAAAGTCACACTAGAAACTCGAGTTTCTAGTGTGACTTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-3300s1c1
Sequence:CCGGGACCTGGTTATTAGCAGAAATCTCGAGATTTCTGCTAATAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028736.1-2213s1c1
Sequence:CCGGCGGAGATAGAATCCTAGCCATCTCGAGATGGCTAGGATTCTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-1563s21c1
Sequence:CCGGCCGCCTCTGATTTCCTATATTCTCGAGAATATAGGAAATCAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-3300s21c1
Sequence:CCGGGACCTGGTTATTAGCAGAAATCTCGAGATTTCTGCTAATAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028736.1-2058s21c1
Sequence:CCGGGAGAGTTCCGGAGCGATTATTCTCGAGAATAATCGCTCCGGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-2138s21c1
Sequence:CCGGAGAGCCGTTTGATCCTATTATCTCGAGATAATAGGATCAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028736.1-269s21c1
Sequence:CCGGGGTATCGGGAGGCATTGATAACTCGAGTTATCAATGCCTCCCGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028736
VALIDATED
GRIP1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-1563s1c1
Sequence:CCGGCCGCCTCTGATTTCCTATATTCTCGAGAATATAGGAAATCAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-1566s1c1
Sequence:CCGGCCTCTGATTTCCTATATTGAACTCGAGTTCAATATAGGAAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028736.1-1714s1c1
Sequence:CCGGCGAGCAAAGTCACACTAGAAACTCGAGTTTCTAGTGTGACTTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028736.1-3300s1c1
Sequence:CCGGGACCTGGTTATTAGCAGAAATCTCGAGATTTCTGCTAATAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028736.1-2213s1c1
Sequence:CCGGCGGAGATAGAATCCTAGCCATCTCGAGATGGCTAGGATTCTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-1563s21c1
Sequence:CCGGCCGCCTCTGATTTCCTATATTCTCGAGAATATAGGAAATCAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-3300s21c1
Sequence:CCGGGACCTGGTTATTAGCAGAAATCTCGAGATTTCTGCTAATAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028736.1-2058s21c1
Sequence:CCGGGAGAGTTCCGGAGCGATTATTCTCGAGAATAATCGCTCCGGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028736.1-2138s21c1
Sequence:CCGGAGAGCCGTTTGATCCTATTATCTCGAGATAATAGGATCAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028736.1-269s21c1
Sequence:CCGGGGTATCGGGAGGCATTGATAACTCGAGTTATCAATGCCTCCCGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021150
GRIP1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor interacting protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-295s21c1
Sequence:CCGGGGCAAGCCAAGAGTATCTAATCTCGAGATTAGATACTCTTGGCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-3123s21c1
Sequence:CCGGCATAGCAGAATCCGGGAATAACTCGAGTTATTCCCGGATTCTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-1986s21c1
Sequence:CCGGAGAGCCGTTTGATCCTATAATCTCGAGATTATAGGATCAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-124s21c1
Sequence:CCGGGATGAGAGTCCCTACACTAAACTCGAGTTTAGTGTAGGGACTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-1906s21c1
Sequence:CCGGGAAAGTTCCGGAGCAATTATTCTCGAGAATAATTGCTCCGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021150
GRIP1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor interacting protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-295s21c1
Sequence:CCGGGGCAAGCCAAGAGTATCTAATCTCGAGATTAGATACTCTTGGCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-3123s21c1
Sequence:CCGGCATAGCAGAATCCGGGAATAACTCGAGTTATTCCCGGATTCTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-1986s21c1
Sequence:CCGGAGAGCCGTTTGATCCTATAATCTCGAGATTATAGGATCAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-124s21c1
Sequence:CCGGGATGAGAGTCCCTACACTAAACTCGAGTTTAGTGTAGGGACTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-1906s21c1
Sequence:CCGGGAAAGTTCCGGAGCAATTATTCTCGAGAATAATTGCTCCGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021150
GRIP1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor interacting protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-295s21c1
Sequence:CCGGGGCAAGCCAAGAGTATCTAATCTCGAGATTAGATACTCTTGGCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-3123s21c1
Sequence:CCGGCATAGCAGAATCCGGGAATAACTCGAGTTATTCCCGGATTCTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-1986s21c1
Sequence:CCGGAGAGCCGTTTGATCCTATAATCTCGAGATTATAGGATCAAACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-124s21c1
Sequence:CCGGGATGAGAGTCCCTACACTAAACTCGAGTTTAGTGTAGGGACTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021150.1-1906s21c1
Sequence:CCGGGAAAGTTCCGGAGCAATTATTCTCGAGAATAATTGCTCCGGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks