EMAIL THIS PAGE TO A FRIEND

GRIP2

glutamate receptor interacting protein 2

101 Gene Product Result for
UniProtKB ID: Q9C0E4, Q8TEH9, Q9H7H3
Gene ID:
Mouse(243547) glutamate receptor interacting protein 2
Rat(171571) glutamate receptor interacting protein 2
chicken(416043) glutamate receptor interacting protein 2
dog(484638) glutamate receptor interacting protein 2
domestic cat(101083410) glutamate receptor interacting protein 2
cow(509537) glutamate receptor interacting protein 2
Horse(100055835) glutamate receptor interacting protein 2
sheep(101109395) glutamate receptor interacting protein 2
domestic guinea pig(100722782) glutamate receptor interacting protein 2
naked mole-rat(101703604) glutamate receptor interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303409 ANTI-GRIP2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001159507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001159507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001159507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053391 MISSION® esiRNA esiRNA human GRIP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080423 Rosetta Predictions human pricing
XM_042936 Rosetta Predictions human pricing
NM_138535 Rosetta Predictions rat pricing
XM_001000130 Rosetta Predictions mouse pricing
XM_979116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314706 predicted 549
2 SASI_Hs02_00314707 predicted 962
3 SASI_Hs02_00314708 predicted 569
4 SASI_Hs02_00314709 predicted 2030
5 SASI_Hs02_00314710 predicted 463
6 SASI_Hs02_00314711 predicted 1428
7 SASI_Hs02_00314712 predicted 2403
8 SASI_Hs02_00314713 predicted 3147
9 SASI_Hs02_00314714 predicted 547
10 SASI_Hs02_00314715 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_042936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292154 predicted 563
2 SASI_Hs01_00292155 predicted 2040
3 SASI_Hs01_00292156 predicted 470
4 SASI_Hs01_00292157 predicted 1439
5 SASI_Hs01_00292158 predicted 2410
6 SASI_Hs01_00292159 predicted 3144
7 SASI_Hs01_00292160 predicted 548
8 SASI_Hs01_00292161 predicted 1537
9 SASI_Hs01_00292162 predicted 770
10 SASI_Hs01_00292163 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098598 predicted 1967
2 SASI_Rn01_00098599 predicted 375
3 SASI_Rn01_00098600 predicted 1620
4 SASI_Rn02_00268169 predicted 3211
5 SASI_Rn01_00098601 predicted 926
6 SASI_Rn01_00098602 predicted 2096
7 SASI_Rn01_00098603 predicted 2209
8 SASI_Rn01_00098604 predicted 394
9 SASI_Rn01_00098606 predicted 557
10 SASI_Rn01_00098607 predicted 258
11 SASI_Rn01_00098605 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354617 predicted 3250
2 SASI_Mm02_00354618 predicted 1054
3 SASI_Mm02_00354619 predicted 916
4 SASI_Mm02_00354620 predicted 378
5 SASI_Mm02_00354621 predicted 3294
6 SASI_Mm02_00354622 predicted 2938
7 SASI_Mm02_00354623 predicted 3269
8 SASI_Mm02_00354624 predicted 693
9 SASI_Mm02_00354625 predicted 1800
10 SASI_Mm02_00354626 predicted 2588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242364 predicted 3250
2 SASI_Mm01_00242366 predicted 1063
3 SASI_Mm01_00242367 predicted 918
4 SASI_Mm01_00242368 predicted 373
5 SASI_Mm02_00446818 predicted 3294
6 SASI_Mm01_00242369 predicted 2937
7 SASI_Mm01_00242370 predicted 3271
8 SASI_Mm01_00242371 predicted 692
9 SASI_Mm02_00446819 predicted 1799
10 SASI_Mm01_00242372 predicted 2589
11 SASI_Mm01_00242365 predicted 991
12 SASI_Mm01_00242373 predicted 2138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080423
GRIP2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor interacting protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-741s21c1
Sequence:CCGGCCTCTACAAGGAGGGCAATAGCTCGAGCTATTGCCCTCCTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2045s21c1
Sequence:CCGGTCATCTCCGACATCAAGAAAGCTCGAGCTTTCTTGATGTCGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1024s21c1
Sequence:CCGGGGACCCTTGATGGTGGAAATACTCGAGTATTTCCACCATCAAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2109s21c1
Sequence:CCGGGCTACTGGCCATTGACAATATCTCGAGATATTGTCAATGGCCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-559s21c1
Sequence:CCGGCTGAACATTGGTGACTATATTCTCGAGAATATAGTCACCAATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1540s21c1
Sequence:CCGGATGAGTCCTCGAACTACAATGCTCGAGCATTGTAGTTCGAGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1811s21c1
Sequence:CCGGACCGTGTCCTGTCCATCAATGCTCGAGCATTGATGGACAGGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2480s21c1
Sequence:CCGGCCGTCACACTGAAGATCAAGACTCGAGTCTTGATCTTCAGTGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080423
GRIP2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor interacting protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-741s21c1
Sequence:CCGGCCTCTACAAGGAGGGCAATAGCTCGAGCTATTGCCCTCCTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2045s21c1
Sequence:CCGGTCATCTCCGACATCAAGAAAGCTCGAGCTTTCTTGATGTCGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1024s21c1
Sequence:CCGGGGACCCTTGATGGTGGAAATACTCGAGTATTTCCACCATCAAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2109s21c1
Sequence:CCGGGCTACTGGCCATTGACAATATCTCGAGATATTGTCAATGGCCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-559s21c1
Sequence:CCGGCTGAACATTGGTGACTATATTCTCGAGAATATAGTCACCAATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1540s21c1
Sequence:CCGGATGAGTCCTCGAACTACAATGCTCGAGCATTGTAGTTCGAGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1811s21c1
Sequence:CCGGACCGTGTCCTGTCCATCAATGCTCGAGCATTGATGGACAGGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2480s21c1
Sequence:CCGGCCGTCACACTGAAGATCAAGACTCGAGTCTTGATCTTCAGTGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080423
GRIP2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor interacting protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-741s21c1
Sequence:CCGGCCTCTACAAGGAGGGCAATAGCTCGAGCTATTGCCCTCCTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2045s21c1
Sequence:CCGGTCATCTCCGACATCAAGAAAGCTCGAGCTTTCTTGATGTCGGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1024s21c1
Sequence:CCGGGGACCCTTGATGGTGGAAATACTCGAGTATTTCCACCATCAAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2109s21c1
Sequence:CCGGGCTACTGGCCATTGACAATATCTCGAGATATTGTCAATGGCCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-559s21c1
Sequence:CCGGCTGAACATTGGTGACTATATTCTCGAGAATATAGTCACCAATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1540s21c1
Sequence:CCGGATGAGTCCTCGAACTACAATGCTCGAGCATTGTAGTTCGAGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-1811s21c1
Sequence:CCGGACCGTGTCCTGTCCATCAATGCTCGAGCATTGATGGACAGGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080423.1-2480s21c1
Sequence:CCGGCCGTCACACTGAAGATCAAGACTCGAGTCTTGATCTTCAGTGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159507
GRIP2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor interacting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-3193s21c1
Sequence:CCGGCAGATGCTCTGAGGTCATTATCTCGAGATAATGACCTCAGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-3053s21c1
Sequence:CCGGATGTTCGCACTCGGGACTTTGCTCGAGCAAAGTCCCGAGTGCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159507.1-3687s21c1
Sequence:CCGGAGGTTGGCCATACAATCATTTCTCGAGAAATGATTGTATGGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-1531s21c1
Sequence:CCGGCCACCCTTGGTGCGATTTATTCTCGAGAATAAATCGCACCAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-1490s21c1
Sequence:CCGGAGCTGCAAGGAGGCATCTTTGCTCGAGCAAAGATGCCTCCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159507
GRIP2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor interacting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-3193s21c1
Sequence:CCGGCAGATGCTCTGAGGTCATTATCTCGAGATAATGACCTCAGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-3053s21c1
Sequence:CCGGATGTTCGCACTCGGGACTTTGCTCGAGCAAAGTCCCGAGTGCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159507.1-3687s21c1
Sequence:CCGGAGGTTGGCCATACAATCATTTCTCGAGAAATGATTGTATGGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-1531s21c1
Sequence:CCGGCCACCCTTGGTGCGATTTATTCTCGAGAATAAATCGCACCAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-1490s21c1
Sequence:CCGGAGCTGCAAGGAGGCATCTTTGCTCGAGCAAAGATGCCTCCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159507
GRIP2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor interacting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-3193s21c1
Sequence:CCGGCAGATGCTCTGAGGTCATTATCTCGAGATAATGACCTCAGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-3053s21c1
Sequence:CCGGATGTTCGCACTCGGGACTTTGCTCGAGCAAAGTCCCGAGTGCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159507.1-3687s21c1
Sequence:CCGGAGGTTGGCCATACAATCATTTCTCGAGAAATGATTGTATGGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-1531s21c1
Sequence:CCGGCCACCCTTGGTGCGATTTATTCTCGAGAATAAATCGCACCAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159507.1-1490s21c1
Sequence:CCGGAGCTGCAAGGAGGCATCTTTGCTCGAGCAAAGATGCCTCCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks