EMAIL THIS PAGE TO A FRIEND

GRIPAP1

GRIP1 associated protein 1

91 Gene Product Result for
Synonyms: GRASP-1
Gene ID:
Human(56850) Summary: This gene encodes a guanine nucleotide exchange factor for the Ras family of small G proteins (RasGEF). In brain studies, the encoded protein was found with the GRIP/AMPA receptor complex. Multiple alternatively spliced transcript variants have been described that encode different protein isoforms; however, the full-length nature and biological validity of all of these variants have not been determined.[provided by RefSeq, Nov 2009]
Mouse(54645) GRIP1 associated protein 1
Rat(116493) GRIP1 associated protein 1
Zebrafish(791150) GRIP1 associated protein 1
domestic cat(101098774) GRIP1 associated protein 1
cow(515550) GRIP1 associated protein 1
dog(491871) GRIP1 associated protein 1
domestic guinea pig(100718820) GRIP1 associated protein 1
naked mole-rat(101714061) GRIP1 associated protein 1
sheep(101113568) GRIP1 associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020137 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065991 MISSION® esiRNA esiRNA human GRIPAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020137 Rosetta Predictions human pricing
NM_207672 Rosetta Predictions human pricing
NM_053807 Rosetta Predictions rat pricing
NM_207670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108826 predicted 707
2 SASI_Hs01_00108827 predicted 782
3 SASI_Hs01_00108828 predicted 1264
4 SASI_Hs01_00108829 predicted 1323
5 SASI_Hs01_00108831 predicted 1083
6 SASI_Hs01_00108832 predicted 956
7 SASI_Hs01_00108833 predicted 1000
8 SASI_Hs01_00108834 predicted 1079
9 SASI_Hs01_00108835 predicted 1290
10 SASI_Hs02_00353018 predicted 1084
11 SASI_Hs01_00108830 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130181 predicted 551
2 SASI_Hs01_00130182 predicted 623
3 SASI_Hs01_00130183 predicted 1109
4 SASI_Hs01_00130184 predicted 1163
5 SASI_Hs01_00130186 predicted 930
6 SASI_Hs01_00130187 predicted 799
7 SASI_Hs01_00130188 predicted 841
8 SASI_Hs01_00130189 predicted 922
9 SASI_Hs01_00130190 predicted 1133
10 SASI_Hs02_00374176 predicted 919
11 SASI_Hs01_00130185 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096966 predicted 1017
2 SASI_Rn01_00096967 predicted 2557
3 SASI_Rn01_00096968 predicted 1075
4 SASI_Rn01_00096969 predicted 2436
5 SASI_Rn01_00096970 predicted 635
6 SASI_Rn01_00096971 predicted 1015
7 SASI_Rn01_00096974 predicted 659
8 SASI_Rn01_00096975 predicted 1155
9 SASI_Rn02_00266631 predicted 2467
10 SASI_Rn02_00266632 predicted 684
11 SASI_Rn01_00096972 predicted 1010
12 SASI_Rn01_00096973 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024482 predicted 2467
2 SASI_Mm01_00024483 predicted 2329
3 SASI_Mm01_00024484 predicted 884
4 SASI_Mm01_00024485 predicted 984
5 SASI_Mm01_00024486 predicted 1031
6 SASI_Mm01_00024487 predicted 1055
7 SASI_Mm01_00024489 predicted 1016
8 SASI_Mm02_00352199 predicted 2438
9 SASI_Mm01_00024490 predicted 2164
10 SASI_Mm01_00024491 predicted 316
11 SASI_Mm01_00024488 predicted 2491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207670
VALIDATED
GRIPAP1 MISSION shRNA Bacterial Glycerol Stock
GRIP1 associated protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207670.1-83s21c1
Sequence:CCGGCCTGGAGCTCCGGACAAATAACTCGAGTTATTTGTCCGGAGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207670.1-2455s21c1
Sequence:CCGGGACCTACAGGATGCAACTATTCTCGAGAATAGTTGCATCCTGTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-1752s21c1
Sequence:CCGGGCTGTGCTCAAAGATCTTAAGCTCGAGCTTAAGATCTTTGAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-302s21c1
Sequence:CCGGTTTGCAGAACAGTACACTTATCTCGAGATAAGTGTACTGTTCTGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-2279s21c1
Sequence:CCGGCGATGAGAACCTTCGAGAAATCTCGAGATTTCTCGAAGGTTCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207670.1-2697s1c2
Sequence:CCGGGCCTTCAACTCTGCATGAGATCTCGAGATCTCATGCAGAGTTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-2552s1c1
Sequence:CCGGGTTTGGGAGATGGACATTAAACTCGAGTTTAATGTCCATCTCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-2339s1c1
Sequence:CCGGCAAGAACATGCACTTGCACAACTCGAGTTGTGCAAGTGCATGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-990s1c1
Sequence:CCGGGAACTGAATATGCTTCGGGAACTCGAGTTCCCGAAGCATATTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207670
VALIDATED
GRIPAP1 MISSION shRNA shRNA Plasmid DNA
GRIP1 associated protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207670.1-83s21c1
Sequence:CCGGCCTGGAGCTCCGGACAAATAACTCGAGTTATTTGTCCGGAGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207670.1-2455s21c1
Sequence:CCGGGACCTACAGGATGCAACTATTCTCGAGAATAGTTGCATCCTGTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-1752s21c1
Sequence:CCGGGCTGTGCTCAAAGATCTTAAGCTCGAGCTTAAGATCTTTGAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-302s21c1
Sequence:CCGGTTTGCAGAACAGTACACTTATCTCGAGATAAGTGTACTGTTCTGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-2279s21c1
Sequence:CCGGCGATGAGAACCTTCGAGAAATCTCGAGATTTCTCGAAGGTTCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207670.1-2697s1c2
Sequence:CCGGGCCTTCAACTCTGCATGAGATCTCGAGATCTCATGCAGAGTTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-2552s1c1
Sequence:CCGGGTTTGGGAGATGGACATTAAACTCGAGTTTAATGTCCATCTCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-2339s1c1
Sequence:CCGGCAAGAACATGCACTTGCACAACTCGAGTTGTGCAAGTGCATGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-990s1c1
Sequence:CCGGGAACTGAATATGCTTCGGGAACTCGAGTTCCCGAAGCATATTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207670
VALIDATED
GRIPAP1 MISSION shRNA Lentiviral Transduction Particles
GRIP1 associated protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207670.1-83s21c1
Sequence:CCGGCCTGGAGCTCCGGACAAATAACTCGAGTTATTTGTCCGGAGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207670.1-2455s21c1
Sequence:CCGGGACCTACAGGATGCAACTATTCTCGAGAATAGTTGCATCCTGTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-1752s21c1
Sequence:CCGGGCTGTGCTCAAAGATCTTAAGCTCGAGCTTAAGATCTTTGAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-302s21c1
Sequence:CCGGTTTGCAGAACAGTACACTTATCTCGAGATAAGTGTACTGTTCTGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207670.1-2279s21c1
Sequence:CCGGCGATGAGAACCTTCGAGAAATCTCGAGATTTCTCGAAGGTTCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207670.1-2697s1c2
Sequence:CCGGGCCTTCAACTCTGCATGAGATCTCGAGATCTCATGCAGAGTTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-2552s1c1
Sequence:CCGGGTTTGGGAGATGGACATTAAACTCGAGTTTAATGTCCATCTCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-2339s1c1
Sequence:CCGGCAAGAACATGCACTTGCACAACTCGAGTTGTGCAAGTGCATGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_207670.1-990s1c1
Sequence:CCGGGAACTGAATATGCTTCGGGAACTCGAGTTCCCGAAGCATATTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020137
VALIDATED
GRIPAP1 MISSION shRNA Bacterial Glycerol Stock
GRIP1 associated protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149416    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020137.3-2767s1c1
Sequence:CCGGCAGGGATTTCTCCTTCTTCTTCTCGAGAAGAAGAAGGAGAAATCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020137.3-123s1c1
Sequence:CCGGGAACTACGCAAGAATGGTGTTCTCGAGAACACCATTCTTGCGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-2663s1c1
Sequence:CCGGCTTGGGAGACTGGACATTAAACTCGAGTTTAATGTCCAGTCTCCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-717s1c1
Sequence:CCGGCTTGCTAAGCTCTCCGAGAAACTCGAGTTTCTCGGAGAGCTTAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-207s1c1
Sequence:CCGGGCACTGAGCAAGAGCAAGAAACTCGAGTTTCTTGCTCTTGCTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-1563s1c1
Sequence:CCGGGAACTTCAAGCTCAGGTACATCTCGAGATGTACCTGAGCTTGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-1572s1c1
Sequence:CCGGGCTCAGGTACATTCCATGGATCTCGAGATCCATGGAATGTACCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020137
VALIDATED
GRIPAP1 MISSION shRNA shRNA Plasmid DNA
GRIP1 associated protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149416    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020137.3-2767s1c1
Sequence:CCGGCAGGGATTTCTCCTTCTTCTTCTCGAGAAGAAGAAGGAGAAATCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020137.3-123s1c1
Sequence:CCGGGAACTACGCAAGAATGGTGTTCTCGAGAACACCATTCTTGCGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-2663s1c1
Sequence:CCGGCTTGGGAGACTGGACATTAAACTCGAGTTTAATGTCCAGTCTCCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-717s1c1
Sequence:CCGGCTTGCTAAGCTCTCCGAGAAACTCGAGTTTCTCGGAGAGCTTAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-207s1c1
Sequence:CCGGGCACTGAGCAAGAGCAAGAAACTCGAGTTTCTTGCTCTTGCTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-1563s1c1
Sequence:CCGGGAACTTCAAGCTCAGGTACATCTCGAGATGTACCTGAGCTTGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-1572s1c1
Sequence:CCGGGCTCAGGTACATTCCATGGATCTCGAGATCCATGGAATGTACCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020137
VALIDATED
GRIPAP1 MISSION shRNA Lentiviral Transduction Particles
GRIP1 associated protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149416    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020137.3-2767s1c1
Sequence:CCGGCAGGGATTTCTCCTTCTTCTTCTCGAGAAGAAGAAGGAGAAATCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020137.3-123s1c1
Sequence:CCGGGAACTACGCAAGAATGGTGTTCTCGAGAACACCATTCTTGCGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-2663s1c1
Sequence:CCGGCTTGGGAGACTGGACATTAAACTCGAGTTTAATGTCCAGTCTCCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-717s1c1
Sequence:CCGGCTTGCTAAGCTCTCCGAGAAACTCGAGTTTCTCGGAGAGCTTAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-207s1c1
Sequence:CCGGGCACTGAGCAAGAGCAAGAAACTCGAGTTTCTTGCTCTTGCTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-1563s1c1
Sequence:CCGGGAACTTCAAGCTCAGGTACATCTCGAGATGTACCTGAGCTTGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020137.3-1572s1c1
Sequence:CCGGGCTCAGGTACATTCCATGGATCTCGAGATCCATGGAATGTACCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)