EMAIL THIS PAGE TO A FRIEND

GRK1

G protein-coupled receptor kinase 1

70 Gene Product Result for
Synonyms: GPRK1 RHOK RK
UniProtKB ID: Q15835, Q53X14
Gene ID:
Human(6011) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates rhodopsin and initiates its deactivation. Defects in GRK1 are known to cause Oguchi disease 2 (also known as stationary night blindness Oguchi type-2). [provided by RefSeq, Jul 2008]
Mouse(24013) G protein-coupled receptor kinase 1
Rat(81760) G protein-coupled receptor kinase 1
chicken(395431) G protein-coupled receptor kinase 1
domestic cat(101092327) G protein-coupled receptor kinase 1
cow(281457) G protein-coupled receptor kinase 1
dog(485557) G protein-coupled receptor kinase 1
domestic guinea pig(100731414) G protein-coupled receptor kinase 1
naked mole-rat(101697548) G protein-coupled receptor kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0758 AQUA Peptide GITVEEAAPTA[K] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085701 MISSION® esiRNA esiRNA targeting mouse Grk1 (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
14-935-M GRK1, active 10 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002929 Rosetta Predictions human pricing
NM_031096 Rosetta Predictions rat pricing
NM_011881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033179 predicted 310
2 SASI_Hs01_00033180 predicted 1614
3 SASI_Hs01_00033181 predicted 386
4 SASI_Hs01_00033183 predicted 1713
5 SASI_Hs01_00033184 predicted 1087
6 SASI_Hs01_00033185 predicted 1431
7 SASI_Hs01_00033186 predicted 828
8 SASI_Hs01_00033187 predicted 1460
9 SASI_Hs01_00033188 predicted 1335
10 SASI_Hs02_00334759 predicted 1539
11 SASI_Hs01_00033182 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109215 predicted 681
2 SASI_Rn02_00264344 predicted 1690
3 SASI_Rn01_00109217 predicted 1389
4 SASI_Rn01_00109218 predicted 1531
5 SASI_Rn01_00109219 predicted 898
6 SASI_Rn01_00109220 predicted 1578
7 SASI_Rn01_00109221 predicted 1215
8 SASI_Rn01_00109222 predicted 1171
9 SASI_Rn01_00109223 predicted 801
10 SASI_Rn02_00264345 predicted 813
11 SASI_Rn01_00109214 predicted 1066
12 SASI_Rn01_00109216 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084295 predicted 1382
2 SASI_Mm01_00084296 predicted 1366
3 SASI_Mm01_00084297 predicted 1237
4 SASI_Mm01_00084298 predicted 1230
5 SASI_Mm02_00321675 predicted 1641
6 SASI_Mm01_00084299 predicted 1011
7 SASI_Mm01_00084300 predicted 996
8 SASI_Mm02_00321676 predicted 1021
9 SASI_Mm02_00321677 predicted 1752
10 SASI_Mm01_00084304 predicted 1447
11 SASI_Mm01_00084301 predicted 1724
12 SASI_Mm01_00084302 predicted 1149
13 SASI_Mm01_00084303 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002929
GRK1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-863s1c1
Sequence:CCGGCTCTGGCCTATGCGTTTGAAACTCGAGTTTCAAACGCATAGGCCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-388s1c1
Sequence:CCGGGACTATGACACGGCAGACAATCTCGAGATTGTCTGCCGTGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-1344s1c1
Sequence:CCGGCGTGAAGTACCCTGATAAGTTCTCGAGAACTTATCAGGGTACTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-945s1c1
Sequence:CCGGCTACAACGTGAATGAGGAGAACTCGAGTTCTCCTCATTCACGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-372s1c1
Sequence:CCGGCTGGAAAGACATCGAGGACTACTCGAGTAGTCCTCGATGTCTTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-463s1c1
Sequence:CCGGGCCAAACTCTTCTGCAGCTTCCTCGAGGAAGCTGCAGAAGAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-1682s1c1
Sequence:CCGGCGGGCATCTTTGGCGAGCTGACTCGAGTCAGCTCGCCAAAGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-1466s1c1
Sequence:CCGGCCCTCTTCAAGGACCTTAACTCTCGAGAGTTAAGGTCCTTGAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002929.2-1901s1c1
Sequence:CCGGCGTGGTTCCCTCCACCCAGGTCTCGAGACCTGGGTGGAGGGAACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002929
GRK1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-863s1c1
Sequence:CCGGCTCTGGCCTATGCGTTTGAAACTCGAGTTTCAAACGCATAGGCCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-388s1c1
Sequence:CCGGGACTATGACACGGCAGACAATCTCGAGATTGTCTGCCGTGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-1344s1c1
Sequence:CCGGCGTGAAGTACCCTGATAAGTTCTCGAGAACTTATCAGGGTACTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-945s1c1
Sequence:CCGGCTACAACGTGAATGAGGAGAACTCGAGTTCTCCTCATTCACGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-372s1c1
Sequence:CCGGCTGGAAAGACATCGAGGACTACTCGAGTAGTCCTCGATGTCTTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-463s1c1
Sequence:CCGGGCCAAACTCTTCTGCAGCTTCCTCGAGGAAGCTGCAGAAGAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-1682s1c1
Sequence:CCGGCGGGCATCTTTGGCGAGCTGACTCGAGTCAGCTCGCCAAAGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-1466s1c1
Sequence:CCGGCCCTCTTCAAGGACCTTAACTCTCGAGAGTTAAGGTCCTTGAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002929.2-1901s1c1
Sequence:CCGGCGTGGTTCCCTCCACCCAGGTCTCGAGACCTGGGTGGAGGGAACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002929
GRK1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-863s1c1
Sequence:CCGGCTCTGGCCTATGCGTTTGAAACTCGAGTTTCAAACGCATAGGCCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-388s1c1
Sequence:CCGGGACTATGACACGGCAGACAATCTCGAGATTGTCTGCCGTGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-1344s1c1
Sequence:CCGGCGTGAAGTACCCTGATAAGTTCTCGAGAACTTATCAGGGTACTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-945s1c1
Sequence:CCGGCTACAACGTGAATGAGGAGAACTCGAGTTCTCCTCATTCACGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002929.x-372s1c1
Sequence:CCGGCTGGAAAGACATCGAGGACTACTCGAGTAGTCCTCGATGTCTTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-463s1c1
Sequence:CCGGGCCAAACTCTTCTGCAGCTTCCTCGAGGAAGCTGCAGAAGAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-1682s1c1
Sequence:CCGGCGGGCATCTTTGGCGAGCTGACTCGAGTCAGCTCGCCAAAGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002929.2-1466s1c1
Sequence:CCGGCCCTCTTCAAGGACCTTAACTCTCGAGAGTTAAGGTCCTTGAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002929.2-1901s1c1
Sequence:CCGGCGTGGTTCCCTCCACCCAGGTCTCGAGACCTGGGTGGAGGGAACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011881
GRK1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1240s1c1
Sequence:CCGGGCAGAATAAGACCAAGGGCTACTCGAGTAGCCCTTGGTCTTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-686s1c1
Sequence:CCGGCCCTTCCAGGAATACCTAGAACTCGAGTTCTAGGTATTCCTGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1625s1c1
Sequence:CCGGCCAGACTCTAGGACTGTCTATCTCGAGATAGACAGTCCTAGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-865s1c1
Sequence:CCGGGCTCAACAAGAAACGGCTGAACTCGAGTTCAGCCGTTTCTTGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1297s1c1
Sequence:CCGGGCGAGGTGAAGAATACGACTTCTCGAGAAGTCGTATTCTTCACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011881.3-2048s21c1
Sequence:CCGGCCTGGTACTTGGACTTAATATCTCGAGATATTAAGTCCAAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011881.3-1018s21c1
Sequence:CCGGTGATGGCAATATCCGAATTTCCTCGAGGAAATTCGGATATTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011881.3-1897s21c1
Sequence:CCGGCAGTCCTATTTGTCCTATTTCCTCGAGGAAATAGGACAAATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011881.3-907s21c1
Sequence:CCGGAGAACCACGGGCCATCTATTACTCGAGTAATAGATGGCCCGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011881
GRK1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1240s1c1
Sequence:CCGGGCAGAATAAGACCAAGGGCTACTCGAGTAGCCCTTGGTCTTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-686s1c1
Sequence:CCGGCCCTTCCAGGAATACCTAGAACTCGAGTTCTAGGTATTCCTGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1625s1c1
Sequence:CCGGCCAGACTCTAGGACTGTCTATCTCGAGATAGACAGTCCTAGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-865s1c1
Sequence:CCGGGCTCAACAAGAAACGGCTGAACTCGAGTTCAGCCGTTTCTTGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1297s1c1
Sequence:CCGGGCGAGGTGAAGAATACGACTTCTCGAGAAGTCGTATTCTTCACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011881.3-2048s21c1
Sequence:CCGGCCTGGTACTTGGACTTAATATCTCGAGATATTAAGTCCAAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011881.3-1018s21c1
Sequence:CCGGTGATGGCAATATCCGAATTTCCTCGAGGAAATTCGGATATTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011881.3-1897s21c1
Sequence:CCGGCAGTCCTATTTGTCCTATTTCCTCGAGGAAATAGGACAAATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011881.3-907s21c1
Sequence:CCGGAGAACCACGGGCCATCTATTACTCGAGTAATAGATGGCCCGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011881
GRK1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1240s1c1
Sequence:CCGGGCAGAATAAGACCAAGGGCTACTCGAGTAGCCCTTGGTCTTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-686s1c1
Sequence:CCGGCCCTTCCAGGAATACCTAGAACTCGAGTTCTAGGTATTCCTGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1625s1c1
Sequence:CCGGCCAGACTCTAGGACTGTCTATCTCGAGATAGACAGTCCTAGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-865s1c1
Sequence:CCGGGCTCAACAAGAAACGGCTGAACTCGAGTTCAGCCGTTTCTTGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011881.1-1297s1c1
Sequence:CCGGGCGAGGTGAAGAATACGACTTCTCGAGAAGTCGTATTCTTCACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011881.3-2048s21c1
Sequence:CCGGCCTGGTACTTGGACTTAATATCTCGAGATATTAAGTCCAAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011881.3-1018s21c1
Sequence:CCGGTGATGGCAATATCCGAATTTCCTCGAGGAAATTCGGATATTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011881.3-1897s21c1
Sequence:CCGGCAGTCCTATTTGTCCTATTTCCTCGAGGAAATAGGACAAATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011881.3-907s21c1
Sequence:CCGGAGAACCACGGGCCATCTATTACTCGAGTAATAGATGGCCCGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks